... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
... Ph.D. thesis - "Continuous minimization methods with variable metric' . ... A continuous projection gradient method of second order with variable metric has been proposed, the convergence theorem was proved. ... T.V. Amotchkina, A. S. Antipin, F.P. Vasiliev Regularized continuous minimization method with variable metric for problems with inaccurate input data// Vestnik MGU, S. 15, Comp. ... T.V. Amotchkina, A. S. Antipin, F.P. Vasiliev Continuous second order minimization method with variable metric...
Space Weather . ... Space weather . ... 3D magnetosphere . ... Data . ... Magnetosphere . Solar wind forecast . Dst forecast . ... Degrees) . ... 2012 Space Monitoring Data Center . ...
... Квантовая теория . ... Непертурбативная низкоэнергетическая физика адронов и лептонов (руководители - проф. К.А.Свешников, проф. А.Е.Дорохов). ... Методы квантовой теории поля в физике конденсированного состояния (руководители - с.н.с. О.В.Павловский, с.н.с. М.В.Улыбышев). Кафедра активно участвует в организации и проведении ежегодных международных семинаров по проблемам квантовой теории поля и теории гравитации в ИФВЭ - Протвино. ... Phys. Rev. D 85 (2012) 094022, arXiv: 1110.6059. ...
УЧРЕЖДЕНИЕ ВЫСШЕГО ПРОФЕССИОНАЛЬНОГО ОБРАЗОВАНИЯ МОСКОВСКИЙ ГОСУДАРСТВЕННЫЙ УНИВЕРСИТЕТ ИМ. М.В.ЛОМОНОСОВА ФИЗИЧЕСКИЙ ФАКУЛЬТЕТ КАФЕДРА АНГЛИЙСКОГО ЯЗЫКА Утверждаю Декан физического факультета МГУ им. М.В.Ломоносова профессор Н.Н. Сысоев « » 2014 г. ПРОГРАММА вступительного экзамена в аспирантуру ПО ДИСЦИПЛИНЕ «ИНОСТРАННЫЙ ЯЗЫК» (АНГЛИЙСКИЙ) Утверждена на заседании Ученого совета физического ... Инфинитив в функции подлежащего, определения, дополнения, обстоятельства, вводного оборота. ...
[
Текст
]
Ссылки http://aspirant.phys.msu.ru/for_intrants/ekzameny/programma_engl.doc -- 59.5 Кб -- 27.08.2015 Похожие документы
... 290 ). 290--320 ), (, 320--400 ) (400--700 ). ... 38 Biophysics (or biological physics) is an interdisciplinary science studing physical and physico-chemical mechanisms of biological processes. ... Biophysics Department of Biological Faculty, Lomonosov Moscow State University, was founded by Prof. Boris N. Tarusov in 1953. ... Biophysics Department of Biological Faculty of MSU provides top-class qualification to young scientists for their work in the field of fundamental and applied biophysics. ...
... О факультете | ... Структура факультета . ... Короткометражный анимационный фильм российского режиссера Константина Бронзита "Мы не можем жить без космоса" вошел в шорт-лист премии "Оскар"(Oscar) в номинации "Лучший мультфильм". ... На получение "Оскара" в номинации "Лучший мультфильм" также претендуют: "Медвежья история" (Bear Story, Чили), "Автопортреты" (Carface, Канада), "Если бы я был Богом.. ... 2009-2014 Высшая школа телевидения МГУ им. М.В.Ломоносова . ...
... The subjects of the Colloquium-458 cover important problems dealing with the verification of constitutive equations, the organization of experiments, the connection between microstructures and mechanical properties and the effective utilization of the modern FEM packages. ... Institute of Mechanics, Lomonosov Moscow State University, Michurinsky Prospekt, 1, 117192, Moscow, Russia . ... S.-Petersburg, 195251, Russia. ... Institute for Problems in Mechanics of Russian Academy of Sciences . ...
... 07.04.2016 (Thursday) Session 1 10:00-10:20 10:20-10:40 10:40-11:00 11:00-11:20 11:20-11:40 (chairman M. Stynes) N. Kopteva V. Andreev H.-G. Roos S. Franz, H.-G. Roos A posteriori error estimates for singularly perturbed reactiondiffusion problems on anisotropic meshes. ... Numerical solution of a singularly perturbed initial-boundary value problem with a Neumann condition for a parabolic equation. ... Boundary layer solutions to time-periodic singularly perturbed parabolic problems. ...
[
Текст
]
Ссылки http://math.phys.msu.ru/data/283/Programme_13th_Workshop.pdf -- 621.4 Кб -- 05.04.2016 Похожие документы
LUT Summer School: www.lut.fi/summerschool summerschool@lut.fi Guide for Student Advisers Greetings from your colleagues at Lappeenranta University of Technology! ... With the wide-ranging selection of courses on-offer during the LUT Summer School we aim to both challenge and inspire students. ... Lappeenranta and LUT Lappeenranta is located some 220 km northeast of Finland's capital, and about 230 km northwest of St. Petersburg, Russia. ... The fee will be given on the LUT Summer School web pages. ...
[
Текст
]
Ссылки http://www.phys.msu.ru/rus/about/structure/admin/OTDEL-FOREIGN/INVITATIONS/LUT_Summer_School_2013_staff.pdf -- 448.5 Кб -- 17.01.2013 Похожие документы
... Русский язык как иностранный . ... Политика и английский язык . ... Большинство людей, хоть как-то причастных к данной проблеме, признают, что в настоящее время состояние английского языка оставляет желать лучшего, однако вместе с этим ясно, что едва ли даже сознательные меры помогут исправить данное положение дел. ... Он становится скверным и неточным из-за недалекости нашего мышления, а наша собственная неаккуратность в выборе слов, в свою очередь, позволяет нам мыслить на не столь высоком уровне....
... Полная версия: Превед неспящим . Грация-МГУ::Форум > Общение > Общение . ... Aug 30 2007, 00:14 . ... O'Rey . ... Цитата(Reaper @ Aug 30 2007, 01:04) . ... George: Condi! ... Condi: Sir, I have the report here about the new leader of China. George: Great. ... Condi: Hu is the new leader of China. George: That's what I want to know. Condi: That's what I'm telling you. George: That's what I'm asking you. ... Condi: Yes. ... Condi: Hu. ... George: Look, Condi. ... Sep 1 2007, 02:43 . ...
... Veselovsky, V.A., Djanumov D.A. The use of biophysical methods in the study of adaptive reactions of plants, in connection with the problem of resistance. ... Kulaeva, O.N., Mikulovich T.P., Veselova, T.V., Veselovsky, V.A., Kukina, I.M., Klyueva N.Yu. ... Veselovsky, V.A., Veselova T.V . ... Nauka, Moscow (in Russian).1990. 200 p. Veselova T.V., Veselovsky V.A., Chernavsky D.S. Stress of Plant: A Biophysical Approach. ... Veselova T.V., Veselovsky V.A. Photosynthesis and stress of plant cells. ...
Optical Transport N etwork (OTN) Tutorial Disclaimer: This is a Tutorial. This is NOT a Recommendation! This tutorial has no standards significance. It is purely for educational purposes. In case of conflict between the material contained in the tutorial and the material of the relevant Recommendation the latter always prevails. This tutorial should NOT be used as a reference; only the relevant Recommendations can be referenced. Summary This document provides a tutorial for Optical Transport Network stand
[
Текст
]
Ссылки http://lvk.cs.msu.su/~bahmurov/course_advanced_networks/ITU_OTN_Tutorial.pdf -- 583.5 Кб -- 21.09.2015 Похожие документы
... H. Purcell: The Fairy Queen - Act II . Г. Перселл: Королева фей - Акт II . Act I . ... The fairies entertain their queen with songs dances until Titania asks them to sing her a lullaby: immediately four allegorical figures - Night, Mystery, Secresie and Sleep - approach to do her bidding. ... Феи развлекают свою королеву песнями и танцами, пока она не просит спеть ей колыбельную: тотчас же четыре аллегорические фигуры - Ночь, Тайна, Секрет и Сон - приближаются, чтобы выполнить ее приказания. ...
... International Olympiad БЂњNanotechnologies БЂ“ Breakthrough to the Future!БЂќ . ... The Olympiad allows the participation of primary, secondary and high school students, BSc, MSc, PhD students, young scientists, teachers and tutors, or enthusiasts of materials sciences and nanotechnologies . ... The site www.nanometer.ru is the official portal of the International Olympiad on nanotechnologies БЂњNanotechnologies БЂ“ Breakthrough to the Future!БЂќ . ...
... Елена Фоменко (2 курс). ... Руководитель В. И. Буник, отдел биокинетики НИИ ФХБ им. А.Н.Белозерского МГУ. ... Руководитель А.Г. Евстафьева, отдел химии и биохимии нуклеопротеидов НИИ ФХБ им. А.Н. Белозерского МГУ. ... Руководитель Н.В. Чичкова, лаборатория молекулярной биологии гена отдела химии и биохимии нуклеопротеидов НИИ ФХБ им. А.Н. Белозерского МГУ. ... Руководитель А.Г. Евстафьева, лаборатория молекулярной биологии гена отдела химии и биохимии нуклеопротеидов НИИ ФХБ им. А.Н. Белозерского...
... Разработка и внедрение образовательных программ повышения квалификации специалистов в области инновационной деятельности . ... Master Degree in Geology . Master Degree in Management . Master Degree in Chemistry . ... 29 марта 2016 г. День открытых дверей Высшей школы инновационного бизнеса . ... Graduate School offersљ Master Degree programms, MBA programms and short-term courses. The Graduate School of Innovative Business carry out education on four Master Degree programms: . ...