... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>6) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search
• About

... Главная Новости Сети Рукопись История Конференции Журналы Ссылки О проекте . ... Journal of Personality and Social Psychology - - Журнал психологии личности и социальной психологии . The British Journal of Social Psychology . Британский журнал социальной психологии". ... Social Forces . Social Forces is a renowned journal of social research highlighting sociological inquiry but also exploring realms shared with social psychology, anthropology, political science, history, and economics. ...

Еще в разделе: (Показать все результаты (>18) - psyberlink.flogiston.ru/ )

Заседание 320 (24 октября 2014 г., совместное заседание с семинаром механико-математического факультета 'Современные проблемы математики и механики') . ... B. Emek Abali (Технический Университет Берлина) Thermodynamically modeling of nonlinear rheological materials and a new energy-based approach to determine the corresponding material parameters. A thermodynamical system can be described by the field equations that are governed by the balance equations and the appropriate constitutive equations. ...

Еще в разделе: (Показать все результаты (>35) - shamolin2.imec.msu.ru/ )

... Likert-type scale response anchors. ... Level of Acceptability . ... Neutral . ... Level of Appropriateness . ... Level of Importance . ... Level of Agreement . ... Somewhat disagree . ... Somewhat agree . ... Never true . ... Rarely true . ... Sometimes but infrequently true . ... Sometimes true . ... Usually true . ... Always true . ... Somewhat true of me . ... Somewhat true of what I believe . ... Priority: . ... Somewhat priority . ... Priority Level . ... satisfied . ... Somewhat satisfied . ...

Еще в разделе: (Показать все результаты (>3) - tukachev.flogiston.ru/ )

News from the UNESCO Chair on Global Problems Journal 1/2016 Moscow Russian Federation Lomonosov Moscow State University Faculty of Global Processes Dear colleagues, UNESCO Chairholders and members, international scientists, friends! ... When inaugurating the Chair, the Rector of the University Acad. ... The visit of the UNESCO Director General to the Moscow University represents an important milestone for the development of the multifaceted cooperation between UNESCO and the Russian Federation. ...

Еще в разделе: (Показать все результаты (>3) - unesco.fgp.msu.ru/ )

• Заведующий кафедрой Кафедра ЮНЕСКО по изучению глобальных проблем на факультете

... 290 ). 290--320 ), (, 320--400 ) (400--700 ). ... 38 Biophysics (or biological physics) is an interdisciplinary science studing physical and physico-chemical mechanisms of biological processes. ... Biophysics Department of Biological Faculty, Lomonosov Moscow State University, was founded by Prof. Boris N. Tarusov in 1953. ... Biophysics Department of Biological Faculty of MSU provides top-class qualification to young scientists for their work in the field of fundamental and applied biophysics. ...

Еще в разделе: (Показать все результаты (>6) - www.biophys.msu.ru/ )

• http://www.biophys.msu.ru/primprod/Figures/Fig_r4.htm

Tempus (159313-TEMPUS-I2009-1-FI-TEMPUS-JPCR) ( , FGSN), (IIT), (RC-CBU, UCL), (Ecole Normale) . ... Department of Neuroscience and Brain Technologies, Italian Department of Integrative Medical Biology, Section for Group for Neural Theory, Department des Etudes Cognitive, Finnish Graduate School of Neuroscience FGSN, the University Institute of Neurology, University College London, UK; F .C. Donders Centre for Cognitive Neuroimaging, Nijmegen, MRC Cognition and Brain Sciences Unit, Cambridge, UK. ...

Еще в разделе: (Показать все результаты (>2) - www.acur.msu.ru/ )

• http://www.acur.msu.ru/docs/Triple%20I.pdf

. Laboratory Head: L.K.Gladilin, tel: (+7 495) 939 3568 , fax: (+7 495) 939 3064 , . Сотрудники Лаборатории (LHPR staff) . Web-pages: . L.K.Gladilin , . V.I.Rud , . I.A.Korzhavina , . Information for our Guests . Справка о создании и первом периоде работы лаборатории, подготовленная в 1980 г. Research Activities: . Scientific Information Search Engines : inSPIRE , ScienceResearch , Google Scholar . Scientific Servers : Interactions , AIP , Elements , Scientific . Feedback: Last modified on March 1, 2016.

Еще в разделе: (Показать все результаты (>6) - lhe.sinp.msu.ru/ )

• Information for our Guests
• L.Gladilin's address Page

О кафедре . ... Е.А. Кудрявцева неоднократно участвовала в Международных конференциях: . 07/1995 International Union of Geodesy and Geophysics XXI, General Assembly (Boulder, Colorado), invited talk . 01/1998 International Conference in honour of I.Petrovskij (Moscow, Russia), invited talk . 09/1998 International Conference in honour of Lev Pontriagin (Moscow, Russia), invited talk . ... 10/2000 International Conference on Low-dimensional Topology (Oberwolfach, Germany), invited talk . ...

Еще в разделе: (Показать все результаты (>33) - dfgm.math.msu.su/ )

• Links

... http://www.springer.com/materials/journal/339 . ... http://www.springer.com/physics/optics/journal/340 . ... http://www.elsevier.com/wps/find/journaldescription.cws_home/967/description#description . ... http://www.elibrary.ru/title_about.asp?id=2435&code=14644258 . ... http://www.springer.com/physics/optics/journal/10297 . ... http://www.springer.com/physics/optics/journal/10946 . ... http://www.springer.com/physics/optics/journal/11490 . ... http://www.elibrary.ru/issues.asp?id=809 . ... Физика. ...

Еще в разделе: (Показать все результаты (>5) - optics.sinp.msu.ru/ )

... Начало www.99ru.ru Страны и континенты Балканы 1159 . ... Введите код товара из каталога. автор PRIJATELJ, KRUNO . Хорватия Dalmatian Painting of the 14th to the 20th centuries . ... Summary: In the project "Selected questions of Dalmatian painting of the 14th to the 20th centuries" research was carried out on numerous not studied or not enough examined questions of the history of painting in Dalmatia in the cited course of time. The paintings from the 14th century were the oldest studied. ...

Еще в разделе: (Показать все результаты (>37) - www.bukivedi.ru/ )

license ]] . CompHEP . Trace: license . ... This Licence entitles the Licensee (one person) and the Licensee 's research group to obtain a copy of the source or executable code of CompHEP and/or interfaces of CompHEP to other Monte-Carlo generators and to use the acquired program for academic research or other non-profit purposes within a research group; or, it entitles the Licensee (a company, organisation or computing center) to install the ... CompHEP team . ...

Еще в разделе: (Показать все результаты (>18) - comphep.sinp.msu.ru/ )

• contacts [CompHEP]
• tutorials [CompHEP]
• web_links [CompHEP]

... Master Degree in Geology . Master Degree in Management . Master Degree in Chemistry . ... 06/04/2016 . ... 29 марта 2016 г. День открытых дверей Высшей школы инновационного бизнеса . ... 29/09/2015 . ... Natural resousces management? The purpose of the "Natural resources management" Master?s Degree programme is to educate specialists in the field of natural resource management, environmental management, sustainable development of regions and densely urbanized territories. ...

Еще в разделе: (Показать все результаты (>3) - www.hsib.msu.ru/ )

• Master Degree in Chemistry | Высшая школа инновационного бизнеса МГУ
• Master Degree in Geology | Высшая школа инновационного бизнеса МГУ

Head of sector, acting head of the Computational Geophysics Division of the M.V. Keldysh Institute for Applied Mathematics, RAS. ... Finished the Electrodynamics and Quantum Theory Department of Faculty of Physics, MSU in 1962. ... Ill-posed problems, stochastic processes, theory of approximation. Mechanics and physics of multi-phase media, phenomena in porous media, difference schemes for some classes of mathematical physics problems (filtration, elasticity theory). ...

Еще в разделе: (Показать все результаты (>6) - compmech.math.msu.su/ )

• Список публикаций - А. Н. Козлова - Кафедра вычислительной механики

... This article caused a most lively interest from the readers, and received more than a hundred responses, which contained various versions of construction methods of the Sri Yantra. ... In this way he revealed a good correspondence between the concentric levels built by him in this relationship of the three Sri Yantra and the orbits of the planets of the solar system (Fig. 10, shows the first two out of three stars examined by him) with a divergence from the real diameters of orbits of about 1.5%. ...

Еще в разделе: (Показать все результаты (>11) - www.protein.bio.msu.ru/ )

... Alexey D. Neverov . ... Department of Bioengineering and Bioinformatics, Moscow State University. State Scientific Center GosNIIGenetika. ... EDAS human . EDAS mouse . EDAS dog (not availible now) . EDAS rat (not availible now) . To navigate this site please install the latest version of Macromedia Flash Player for Windows or for Linux . If you do not wish to install Flash you could use text pages with less functionality. ...

Еще в разделе: (Показать все результаты (>3) - edas2.bioinf.fbb.msu.ru/ )

• EDAS (human) - Alternative Splicing DataBase.
• EDAS (mouse) - Alternative Splicing DataBase.

Site navigation: . ... FAQ . ... SPDC Laboratory . Quantum Electronics Chair . ... Site configuration . Error: You currently have Javascript disabled. This website uses Javascript for many elements such as the menus and page customization. Please enable Javascript in your browser for the optimum website experience. Bell's inequality . ... Quantum key distribution . Quantum teleportation . What is Quantum Optics . ... Website design and development - Alex Shurupov, 2009. ...

Еще в разделе: (Показать все результаты (>96) - qi.phys.msu.ru/ )

• Financial support :: Quantum Information Laboratory
• Sergei Kulik: Our group financing

. Область научных интересов . Сотрудники, приглашенные специалисты и студенты . Информация о научных конференциях и семинарах . Основные публикации . Наш адрес . Home page .

Еще в разделе: (Показать все результаты (>40) - www.srcc.msu.ru/ )

... mechanic . ... engineer . ... senior researcher . ... 77 (floor -1) . ... Fedoseev Anatoly Ivanovich . docent . ... spekl@phys.msu.ru . ... Hlystov Vladimir Ivanovich . ... Ivanov Sergey Nikolaevich . leading engineer . 939-31-69 . sni@opts.phys.msu.ru . ... iak@opts.phys.msu.ru . ... Kolobanov Vitaly Nikolaevich . ... 2-07 (SINP MSU) . ... korolenko@optics.npi.msu.su . ... junior researcher . ... researcher . ... researcher (SINP MSU) . ... 71 (floor -1), 4-13(SINP MSU) . ...

Еще в разделе: (Показать все результаты (>3) - opts.phys.msu.ru/ )

• http://opts.phys.msu.ru/eng/menu.html

SUNY-MSU Partnership . ... MSU | ... The State University of New York/Moscow State University partnership dates back to the mid-1970s and owes its existence to the vision of then MSU Rektor Rem Kokhlov and SUNY Chancellor Ernest L. Boyer. ... The first students were exchanged in 1977. ... A SUNY Center on Russia and the United States opened its doors in January 2000, and a sister MSU Center on the United States and Russia was set up in Moscow at MSU?s newly built Science Park. ... suny-msu . ...