Chlorophyll Fluorescence in vivo : A Theory (Part I) . Most part of the photosynthetic pigments in phytoplankton cell reside in peripheral pigment-protein complexes of the light-harvesting antenna (I, see Fig. ... From peripheral antenna complexes, excitation is efficiently transferred to core antenna complexes near photosynthetic reaction centers (II, Fig. 1), where it can be used in the primary photochemical reaction of photosynthesis. ... and phytoplankton concentration . ...

Еще в разделе: (Показать все результаты (>6) - www.biophys.msu.ru/ )

• (Chlorophyll Fluorescence in vivo: A Theory
• Устинин Дмитрий Михайлович

DOI: 10.7256/2222-1972.2014.5.14682 doi « »: ( ) : . ... 526 © NOTA BENE ( «-») « » XI ., ... 527 © NOTA BENE ( «-») : 5 (23) · 2014 DOI: 10.7256/2222-1972.2014.5.14682 . ... XVI­XVIII . ... NOTA BENE ( «-») DOI: 10.7256/2222-1972.2014.5.14682 , [1, 7]. ... 529 © NOTA BENE ( «-») : 5 (23) · 2014 DOI: 10.7256/2222-1972.2014.5.14682 ­ , : « , " "». ... NOTA BENE ( «-») DOI: 10.7256/2222-1972.2014.5.14682 , « » [14, 155]. ... NOTA BENE ( «-») 533 : 5 (23) · 2014 DOI: 10.7256/2222-1972.2014.5.14682 27. ...

Еще в разделе: (Показать все результаты (>5) - www.hist.msu.ru/ )

• Проект ?Виртуальная реконструкция московского Страстного монастыря?

Solid State Physics Chair and Magnetism Department of M.V.Lomonosov Moscow State University . Joint RFBR-Helmholtz grant "Defects in magnetic TiO2" ("DETI.2") (HRJRG-314 & RFBR #12-02-91321-SIG_a"; 01.02.2012 - 01.02.2015): . DETI.2 (English) . ... Midterm Workshop at Moscow State University: . October 9th - 14th 2013, Moscow, Russia . ... Kay Potzger (HZDR): "Diluted magnetic semiconductors and oxides - resurrection"; . ... 19h30 - 22h30: joint Workshop Dinner on the Moscow-river; . ...

Еще в разделе: (Показать все результаты (>22) - magn.phys.msu.ru/ )

• Information about education on magnetism division
• Сотрудники кафедры магнетизма: Радковская Анна Александровна
• Название сайта

... Carbon and Nitrogen As Resources Limiting the Growth of Mono- and Mixed Cultures of Pseudomonas aeruginosa Dissociants P. V. Fursovaa, E. S. Mil'kob, and A. P. Levichc c Department of Biophysics Department of Microbiology Department of General Ecology, Moscow State University, Moscow, 119991 Russia e-mail: fursova @biophys.msu.ru b a Received December 26, 2006 Abstract--New experiments for detection of resources limiting the ... 1997; Levich, 2000). ... 1) (Levich et al., ...

Еще в разделе: (Показать все результаты (>5) - dis.bio.msu.ru/ )

Отчетный год 2009 механико-математический факультет Приложение 1 к таблицам 2-2 и 2-3 Сведения о монографиях, главах в монографиях, учебниках, учебных пособиях и научно-популярных книгах представляется в Управление научной политики и организации научных исследований только в электронном виде по адресу: unir@rector.msu.ru |? ... 1 |Ахметов |Численное |мон | ... 500 |19 |М.: МГУ | ... Ю.Г., |состояний мягких | ... 26 |М.: МЦНМО | ... 222 с|Cambridge | ... Equations. ... й А.М. |представителей в | ...

Еще в разделе: (Показать все результаты (>3) - scidep.math.msu.su/ )

• http://scidep.math.msu.su/Sites/demosite1/Uploads/pred_Lom13_Beloshapka.docs1.pdf

... Геология >> Планетология | ... Добавить новое сообщение . ... Было выделено 19 структур этого класса, что составляет 35.8 % от количества изученных арахноидов ( табл. ... Радарное изображение и геологическая интерпретация района арахноида N246 (венец Наволги). ... Новы и арахноиды на Венере: геологическое строение, классификация и эволюция . Новы и арахноиды на Венере: геологическое строение, классификация и эволюция: Новы и арахноиды на Венере: геологическое строение, классификация и эволюция . ...

Еще в разделе: (Показать все результаты (>22) - phys.web.ru/ )

• Все о геологии :: Анонсы конференций - Минералогия ()
• Все о геологии :: Анонсы конференций - Геохимические науки ()
• Все о геологии :: Анонсы конференций - Геохимия ()

... 46. to give account of... 47. current (n.,adj.) . ... 57. complete v. adj. ,completely . ... 88. equal (v, adj), equally . ... 127. involve, involved (p.I, adj) . ... 134. to mean, meaning (less), means, by means of, mean (adj) . ... 145. reciprocal ( reciprocal relation) . ... 153. result, as a result, to result in / result from . ... 173a. reciprocal ( reciprocal relation) . ... Некоторые часто используемые слова: . ... новости студенты преподаватели лаборатории интернет-олимпиада по химии . ...

Еще в разделе: (Показать все результаты (>3) - www.students.chemport.ru/ )

... Nonlinear fiber optics . ... member of the Editorial Board for the Laser Physics journal . ... Member of the steering committee of the international conference on Raman spectroscopy (ICORS): Budapest, 2002; Brisbane, 2004; Yokohama, 2006; London, 2008 . Member of the steering committee of the International Laser Physics workshop: Bratislava, 2002; Hamburg, 2003; Trieste, 2004; Kyoto, 2005; Lausanne, 2006; Leon, 2007; Trondheim, 2008; Barcelona, 2009 . ... International conference ?Laser Optics? ...

Еще в разделе: (Показать все результаты (>5) - photonicslab.phys.msu.ru/ )

Lomonosov Moscow State University Biological faculty Botanical garden (Russia, http://botsad.msu.ru) Botanical garden of the Komarov Botanical institute (Russia) Russian Iris Society Botanical garden of Taurida National Vernadsky University (Ukraine) The first information letter Dear colleagues! ... Wide range of topics concerning representatives of genus Iris L. are planned to be discussed at the following sections: 1. ... Abstract submission deadline is Apr.1, 2011. ... Rodionenko G.I. Genus Iris. ...

Еще в разделе: (Показать все результаты (>4) - botsad.msu.ru/ )

• http://www.botsad.msu.ru/docs/eng_iris2.doc
• Приложение 6

International Symposium Biological Motility: New facts and hypotheses ================================================= Pushchino , Moscow region, Russia May 12-14, 2014 Chairman of Organizing Committee Prof. Zoya Podlubnaya Institute of Theoretical and Phone (4967)739269 Experimental Biophysics RAS Fax (4967)330553 Pushchino , Moscow region E-mail: motility2014@iteb.ru 142290, Russia Preliminary information Dear colleagues, The ... Deadline for sending abstracts is 1 of March 2014. ...

Еще в разделе: (Показать все результаты (>2) - cytol.bio.msu.ru/ )

... Lecture Cycle: The Cold War: US and URSS, Countercultures and Citizen Diplomacy . ... This lecture offers a comparative analysis of the cultural impact of the cold war on both countries. It then focuses on the countercultures and introduces citizen diplomacy as a bottom-up strategy to end the Cold War. ... Films for the Cold War Lecture Birgit (recommended to see) . ... Russkii vopros (UdSSR 1947; Michail Romm) . ... Sekretnaja missiia (UdSSR 1950; Michail Romm) . ... The Northstar (USA тАЩ43) . ...

Еще в разделе: (Показать все результаты (>7) - discours.philol.msu.ru/ )

• Anna Kotomina
• Events

... Run source ./setup.csh 6. ... When you will start to work next time, run setups in following order : cd /data1/atlas/work source ../software/12.0.8/setup.csh cd testarea/12.0.8/ source $ATLAS_ROOT/../work/cmthome/setup.csh -tag=12.0.8 To exclude first two lines, just add to your .login these lines : # add Atlas env-s : source /data1/atlas/software/12.0.8/setup.csh After that next time just do : source $ATLAS_ROOT/../work/cmthome/setup.csh -tag=12.0.8 cd /data1/atlas/work/testarea/12.0.8/ . ...

Еще в разделе: (Показать все результаты (>2) - lhe.sinp.msu.ru/ )

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>10) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/megablast.out

... Application for transmission electron microscopy investigation at EMAT Form A - Administrative data 1. ... Contact information: | ... Proposal title |max. 200 characters | ... Bright field TEM imaging | ... Electron diffraction: | ... In-situ TEM (provide temperature ranges for observations, melting temperature of | ... Provide more detailed description of the sample preparation (if necessary, max | ... Crystal structure information: | ... Provide crystallographic information (max 1/2 page): | ...

Еще в разделе: (Показать все результаты (>7) - nano.msu.ru/ )

• The 7th International Nanoscience Student Conference, London, 19?22 August 2013

... Working channel dimensions: length - 1200 mm, width - 300 mm, height - 30 mm; 50mm. Air velocity range in a working channel: 5-120 m/s with a step 0,1 m/s. Mass air rate: 0,2-1,3 kg/s . ... Model/flow temperature difference: up to 120C . ... Aerodynamic unit 'SAU-Siemens' was created to investigate heat exchange intensification on the surfaces with complex relief (dimples, grooves, etc) in flat channels at subsonic flow of working medium (air). ...

280. http://uzmu.phys.msu.ru/issue/120102.pdf