... Scientific Effort . ... Cosmic ray astrophysics . Space Physics . ... Nuclear physics . ... The paper was prepared with contributions from Elena Popova from the Skobeltsyn Institute of Nuclear Physics (Lomonosov Moscow State University) and was published in Scientific Reports. ... Federal State Budget Educational Institution of Higher Education M.V.Lomonosov Moscow State University, Skobeltsyn Institute of Nuclear Physics (SINP MSU), 1(2), Leninskie gory, GSP-1, Moscow 119991, Russian Federation . ...
... research | ... Matvey Viktorovich Youdov . ... Organic Chemistry Division, Chemistry Department, Lomonosov Moscow State University, Leninskie Gory, 199899 Moscow, Russia. ... B.S./M.S. in Chemistry "Study of structure of humic substances and their hydrolysis products by 1H and 13C nuclear magnetic resonance spectroscopy techniques" Employment: . ... Current research activity is dealing with investigation of structure of hydrolyses products of humic substances by methods of NMR spectroscopy. | ...
... NetCDF User's Guide for C . Unidata ( http://www.unidata.ucar.edu ) is a National Science Foundation-sponsored program empowering U.S. universities, through innovative applications of computers and networks, to make the best use of atmospheric and related data for enhancing education and research. ... The Network Common Data Form (netCDF) software described in this guide was originally intended to provide a common data access method for the various Unidata applications. ...
О кафедре . ... Динамические задачи теории упругости . ... Математическая теория пластичности . Методы теории упругости . ... Нелинейная теория упругости . ... Прочность и разрушение материалов и элементов конструкций . ... Теория упругости структурно-неоднородных тел . ... Численные методы в теории упругости и пластичности . ... КАФЕДРА ТЕОРИИ УПРУГОСТИ . ... Математические модели, теория эксперимента; долговечность и прочность элементов ответственных конструкций из высоконаполненных полимеров. ...
HOMEPAGES OF MUSCLE PEOPLE or GROUPS AROUND THE WORLD . ... King's College, London . Michael Ferenczi . Imperial College of Science, Technology & Medicine, London . ... Michael Reedy . ... London Muscle Series . ... European Biophysical Societies' Association . European Society for Muscle Research . ... Argonne National Laboratory, USA . ... Daresbury Laboratory, UK . MUSCLE-RELATED PERIODICALS . Biophysical Journal . ... The Journal of Physiology . ...
... Master Degree in Geology . Master Degree in Management . Master Degree in Chemistry . ... 29 марта 2016 г. День открытых дверей Высшей школы инновационного бизнеса . ... T he goal of this Master Degree program is to educate specialists with the knowledge of the newest technologies of geological study, modeling and development of deposits, advanced scientific methods of seismic and geophysical exploration, geophysical well-logging, production enhancement, etc. ...
... 5-я летняя школа по геометрическим методам математической физики, 23-26 июня 2015 г. new . ... Лаборатория "Геометрические методы математической физики" была создана в декабре 2010г. после объявления победителей гранта Правительства Российской Федерации для государственной поддержки научных исследований, проводимых под руководством ведущих ученых в российских образовательных учреждениях высшего профессионального образования. ... на семинаре "Геометрия и группы" состоится доклад: . ...
Service . Analytical Laboratory Provides Service In The Field Of . Applied Statistics. Training in applied statistics and in statistical software tools usage. Formalization of practical problems and solution algorithms choosing. Applied statistical problems solving, using Your data. ... Consultations on choosing of Russian and American software tools for applied statistical problems. Phone/Fax: (095) 939-5306 . e-mail: makarov@makarov.msu.ru . ... Fax . ... InCo . ...
... Astronomy search engine . ... PhysicsWeb Home Page . ... Sternberg Astronomical Institute . ... Astro Space Center Home Page . ... Landau Institute for Theoretical Physics . ... Astronomy and Space Physics Dept of Kiev University . ... NATIONAL RADIO ASTRONOMY OBSERVATORY Home Page . University of Hawaii - Institute for Astronomy . ... Space Telescope Science Institute Home Page . ... Sky & Telescope: The Essential Magazine of Astronomy . ... Springer LINK - Physics Online Library . ... Home . ...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
... Начало www.99ru.ru Страны и континенты Балканы 1159 . ... Введите код товара из каталога. автор PRIJATELJ, KRUNO . Хорватия Dalmatian Painting of the 14th to the 20th centuries . ... Summary: In the project "Selected questions of Dalmatian painting of the 14th to the 20th centuries" research was carried out on numerous not studied or not enough examined questions of the history of painting in Dalmatia in the cited course of time. The paintings from the 14th century were the oldest studied. ...
ITPM MSU . Quantum Computing Page . ... Quantum Computation/Cryptography at LosAlamos . Quantum Information at Los Alamos National Laboratory . Laboratory for Theoretical and Quantum Computing ( Universite de Montreal ) . Quantum information and quantum computation at IBM . ... Centre for Quantum Computation . Quantum Information Page . Quantum Information and Computation . ... Quantum Information and Quantum Computing (by Reinhard F. Werner) . ... c) ITPM MSU 1998, 1999 ...
... Master . ... Participants . ... Zel'dovich asteroid . ... YaB-100 conferences . ... Gnedin Yu.N. Investigation of vacuum polarization in strong magnetic fields of neutron stars: Zel'dovich ideological impetus . ... Doroshkevich A.G. Beyond the limits of the LambdaCDM cosmology . ... Illarionov A.F. Title is discussed . ... Imshennik V.S. Title is discussed . ... Polnarev A.G. Polarization of CMB generated by Cosmological Gravitational Waves . ... Ruzmaikin A.A. A game of chance . ...
... Октябрь 15, 2015 // Комментарии к записи Прием студентов 2-го курса на кафедру ихтиологии отключены // Опубликовано в: Новости | Прием на кафедру ихтиологии студентов 2-го курса состоится . ... Октябрь 15, 2015 // Комментарии к записи День открытых дверей кафедры ихтиологии отключены // Опубликовано в: Новости | ... Ноябрь 11, 2014 // Комментарии к записи Прием студентов 2-го курса на кафедру ихтиологии отключены // Опубликовано в: Новости | ... Биологический факультет МГУ им. М.В. Ломоносова . ...
... Home . ... Board of directors . About the project . ... Read more . ... Project director . ... PhD, Research Associate . Director of the scientific part of the project . ... PhD, Deputy Vice-Rector . Technical Coordinator . ... Project coordinator . ... Coordinator of "Biological information" part of the project . ... Coordinator of "Human biomaterial" part of the project . ... Coordinator of "Animals" part of the project . ... Coordinator of "Plants" part of the project . ...
... Научные исследований . ... Дмитриев Владимир Иванович : Доктор физико-математических наук, профессор кафедры математической физики, . ... Научные работы : В.И. Дмитриев опубликовал более 400 научных работ, в том числе 22 монографии и учебных пособия. ... Барашков Игорь Сергеевич Кандидат физико-математических наук, старший научный сотрудник. ... Область научных интересов: математическое моделирование сложных физических явлений (плазмофизика, физика твердого тела, геофизика, физика атмосферы). ...
... 8 DOI: 10.1093/nar/gkh583 Mapping of the second tetracycline binding site on the ribosomal small subunit of E.coli Maria M. Anokhina1, Andrea Barta2, Knud H. Nierhaus3, Vera A. Spiridonova4 and Alexei M. Kopylov1,4,* Department of Chemistry ... University, 119992 Moscow, Russian Federation Received February 5, 2004; Revised March 22, 2004; Accepted April 14, 2004 1 ABSTRACT Tetracycline blocks stable binding of aminoacyltRNA to the bacterial ...
Research on gas dynamic temperature stratification. Leontev's tube. Photo of experimental model for research on gas dynamic temperature stratification. ... Research on the performance of Leontev's tube operating on natural gas carried out in Saratov. ... Functional diagram of the unit for gas dynamic temperature stratification (Leontev's tube). Experimental model for the research of gas dynamic temperature stratification efficiency . ...