... Biol. (2001) 212, 275 } 294 doi:10.1006/jtbi.2001.2375, available online at http://www.idealibrary.com on Light-triggered pH Banding Pro5le in Chara Cells Revealed with a Scanning pH Microprobe and its Relation to Self-Organization Phenomena A. A. BULYCHEV*, A. A. POLEZHAEV-, S. V. ZYKOV?A, T. YU. ... When exposed to light, internodal cells of Chara and Nitella develop a pattern of alternating acid and alkaline bands along the cell length (Spear et al., ... LIGHT-CONTROLLED PATTERNS FIG. ...

Еще в разделе: (Показать все результаты (>32) - library.biophys.msu.ru/ )

• http://library.biophys.msu.ru/matorin/3413.pdf
• http://library.biophys.msu.ru/PDF/3345.pdf
• http://library.biophys.msu.ru/PDF/3329.pdf

. NON-STATIONARY OPERATION OF THE FAST-FLOW LASERS . AND NEW POSSIBILITIES OF CONTROLLING THE LASER OUTPUT CHARACTERISTICS . A.V. Mushenkov, A.Yu.Loskutov, A.I.Odintsov, A.I.Fedoseev and V.F.Sharkov . Physics department of M.V.Lomonosov Moscow State University, 119899, Vorob'evy gory, Moscow, Russia . Abstract . The dynamics of the lasing of the fast crossflow gas laser with the inhomogeneous steady state pumping in the unstable resonator by means of numerical modeling is investigated. Depending on the

Еще в разделе: (Показать все результаты (>6) - optics.sinp.msu.ru/ )

The Early Music Theatre >> Repertoire >> The Prophetess.. The Prophetess (The History of Dioclesian) is a masterpiece of the English Restoration opera. ... There is little good to say about most late Roman emperors. ... Muscovites know very well a Roman officer who suffered because of his religious beliefs under Dioclesian: the future martyr Saint George the Winner.) ... You shouldn't joke", the prophetess responded, "because you will become an emperor, Dioclus, when you kill Aprus". ...

Еще в разделе: (Показать все результаты (>4) - www.tsm-msu.ru/ )

... Veselovsky, V.A., Djanumov D.A. The use of biophysical methods in the study of adaptive reactions of plants, in connection with the problem of resistance. ... Kulaeva, O.N., Mikulovich T.P., Veselova, T.V., Veselovsky, V.A., Kukina, I.M., Klyueva N.Yu. ... Veselovsky, V.A., Veselova T.V . ... Nauka, Moscow (in Russian).1990. 200 p. Veselova T.V., Veselovsky V.A., Chernavsky D.S. Stress of Plant: A Biophysical Approach. ... Veselova T.V., Veselovsky V.A. Photosynthesis and stress of plant cells. ...

Еще в разделе: (Показать все результаты (>7) - biophys.msu.ru/ )

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>13) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out

International Laser Center of MSU . ... Education . ... Laser Graduate School . ... Home Education Continuing Education and Retraining Program . The International Laser Center of Moscow State University accepts visiting scholars from all over the world for training programs in laser physics and technologies. The ILC offers the following continuing education and retraining programs in these fields: . ... International Retraining and Post-docs Program; . Laser Graduate School short courses . ...

Еще в разделе: (Показать все результаты (>70) - ilc.phys.msu.ru/ )

• Публикация
• Grant detail
• Грант подробно

ВМиК-Online! ... Факультет . ... Абитуриенты . ... Вариант письменного вступительного экзамена . по английскому языку . Отделение бакалавров факультета ВМиК . ... They found that cannabis users are 40 percent less effective in fighting viruses than normal people. ... Группа В Контакте для абитуриентов ВМК МГУ: . Поступление на ВМК МГУ 2012 . Форум абитуриентов ВМК МГУ . ... Телефон приемной комиссии факультета ВМиК МГУ: . ... 2001 2012 ВМиК Online! ...

Еще в разделе: (Показать все результаты (>6) - www.cmc-online.ru/ )

• ВМиК - Online! : Работа для выпускников и студентов ВМК МГУ - Вакансии компании

THE JOURNAL OF CHEMICAL PHYSICS 133, 144101 2010 Effective numbers of modes applied to analysis of internal dynamics of weakly bound clusters A. A. Rybakov,a E. D. Belega, and D. N. Trubnikov Department of ... Russia Received 11 June 2009; accepted 14 September 2010; published online 11 October 2010 The dependence of the volume of the chaotic component in the internal dynamics of triatomic van der Waals clusters on the angular ... When such difference is small, the regular motion disappears. ...

Еще в разделе: (Показать все результаты (>18) - beams.chem.msu.ru/ )

... The philosophical consequences of synergetics, the interdisciplinary theory of evolution and self-organization of complex systems, are being drawn in the paper. ... Key words: complex systems, evolution, nonlinearity, pre-determination, self-organization, soft management, structure-attractors, synergetics 1. ... The spectra of possible, `allowed' structures correspond to sets of the eigenfunctions of the nonlinear equations describing the evolutionary processes in the complex system. ...

Еще в разделе: (Показать все результаты (>24) - www.students.chemport.ru/ )

• тест ?4 по английскому языку
• тест ?2 по английскому языку

Series on Stability, Vibration and Control of Systems, Series A - Vol. ... MULTIPARAMETER STABILITY THEORY WITH MECHANICAL APPLICATIONS . ... This book deals with fundamental problems, concepts, and methods of multiparameter stability theory with applications in mechanics. ... Introduction to Stability Theory . ... Read Full Review . ... Since Bolotin's pioneering book on nonconservation problems on the theory of elastic stability, not many books appeared at such a high level, such as this one. ...

Еще в разделе: (Показать все результаты (>30) - mailybaev.imec.msu.ru/ )

• Book review by Professor Wolfhard Kliem
• Book review by Professor Teodor M. Atanackovic

... We have compiled the Catalogue of extragalactic supernovae using the GCVS card catalogue. ... Doubtful (?), or rejected (-) SN 8 A1 --- RemFlag [*] The '*' indicates a remark in sn_rem.dat 10- 19 A10 --- Gal Parent galaxy designation 21- 22 I2 h RAh Right Ascension 1950 of Parent galaxy 23- 24 I2 min RAm Right Ascension 1950 (minutes) 25- 28 F4.1 s RAs Right Ascension 1950 (seconds) 29 A1 --- DE- Declination 1950 (sign) 30- 31 I2 deg DEd Declination 1950 of Parent ...

Еще в разделе: (Показать все результаты (>87) - sai.msu.ru/ )

• GCVS Query forms
• General Catalogue of Variable Stars: What's new.
• International School "Frontiers in Numerical Gravitational Astrophysics"

Russian TeX Disk . ... Please, use "Save link as" (right mouse button) for downloading files, otherwise binary files will be corrupted. What is russian TeX disk . ... Some TeX versions and tools are installed/russified and can be started directly from CD; other are only distributives plus additional files for their russification. ... FPTEX . ... Directory russian.add: Generic files (mf-sources, pfb-fonts and hyphen file) for russification of any-TeX-realizations in: . ... file readme: . ...

Еще в разделе: (Показать все результаты (>4) - tex.bog.msu.ru/ )

... Gpu | ... 10 , MULtI- GPU ABSoft Neat Video Adobe After Effects CC Autodesk Flame Premium Boris FX Continuum Complete Cinnafilm Dark Energy Plug-in CoreMelt complete eyeon Fusion GenArts Monsters Gt GenArts Sapphire roBUSKEY Neat Video open FX NewBlueFX Video Essentials NewBlue titler Pro Pixelan AnyFX re:Vision Effects red Giant Effects Suite red Giant Magic Bullet Looks the Foundry HIEro the Foundry NUKE and NUKEX Video Copilot Software Element 3D ... Q=Quadro Gpu, T=Tesla Gpu. ...

Еще в разделе: (Показать все результаты (>5) - ccoe.msu.ru/ )

... B.V. Somov . head of the department . ... room 80 . ... senior research felow . ... research felow . ... research fellow . ... Our department performes the following most perspective studies: . Special analytical and numerical experimental investigations of the solar plasma involved in the magnetic reconnection process at the Sun. ... Head of the seminar: Prof. B.V. Somov. ... 27 September 2013 The Solar Physics Department was visited by journalists of the leading Russian TV channel "Vesti-1". ...

Еще в разделе: (Показать все результаты (>2) - sun.sai.msu.ru/ )

Lomonosov Moscow State University FACULTY OF ARTS 2011 ALEXANDER LOBODANOV DEAN OF THE FACULTY OF ARTS WxtЊ vҐЂЂxtzтxс4 g{x YtvтЂрч Ґy TЊрс уxЊx tvvx¶рxw |° ... Since 2003 he has been chairman of the Department of Semiotics and the General Theory of History, founded by him, the first of its kind in Europe. ... Department of Semiotics and the General Theory of Arts The Department of Semiotics and the General Theory of Arts is a theoretical department. ... Galina Zadneprovskaya manages this department. ...

256. http://belyakov.imec.msu.ru/papers/PhysCon2005.pdf

257. Laboratory of Mechanics of Multiphase Media

258. http://www.elch.chem.msu.ru/mole/lecture/probst.pdf

259. http://num-anal.srcc.msu.su/list_wrk/ps1/ch3st4.ps

260. International Cooperation Info