... Alexey D. Neverov . ... Department of Bioengineering and Bioinformatics, Moscow State University. State Scientific Center GosNIIGenetika. ... EDAS human . EDAS mouse . EDAS dog (not availible now) . EDAS rat (not availible now) . To navigate this site please install the latest version of Macromedia Flash Player for Windows or for Linux . If you do not wish to install Flash you could use text pages with less functionality. ...
Conference on 'Reflections on the atomic nucleus', 28.06.2015, Liverpool, UK. This meeting, see http://ns.ph.liv.ac.uk/Reflections2015 , will touch upon a few sub-topics of current interest in nuclear structure physics including aspects of nuclear collectivity, strengths, shell evolution and super-heavy elements as well as sessions devoted to nuclear astrophysics, fundamental physics and new experimental probes. ... The conference fee is ?100. ...
Это новая версия каталога журналов, первоначально созданная Владимиром Мельгуновым. ... biology . ... Elsevier Science ] . ... не определено] . ... Wiley Interscience ] . ... Indian Journal of Biochemistry and Biophysics . Bioline International ] . ... International Journal for Numerical and Analytical Method.. ... International Journal for Numerical Methods in Engineering . ... International Journal for Numerical Methods in Fluids . ... International Journal of Auditing . ... JCatalog | ...
... Medium (solvent) coordinates 3. Quantum effect of solvent on activation barrier 4. ... sucrose solutions: C D ( w) = + + 1 + (iw C ) 1 + iw water-EG mixtures: D 3 1 2 ( ) = + + + 1 + i 2 1 1 + i 2 2 1 + i 2 3 series N solvent modes Solvent reorganization energy (exact expansion ) correlation times K ( ) = 2k BT Solvent correlation function i =1 N i exp (- / ) * i i =1 N i = 1 i is the contribution of i-th mode to the solvent reorganization energy The solvent reorganization ...
... О кафедре . ... КРИВОНОЖКО Владимир Егорович (11.06.1948, г. Москва) д.физ.-мат.н., профессор МФТИ, зав. кафедры АСУ МИСИС. ... Krivonozhko V. E., F rsund F. R. Lychev A. V. Terminal units in DEA: Definition and Determination // University of Oslo. ... F rsund F. R., Krivonozhko V. E., Lychev A. V. Hidden Effects in DEA Models //Differential Equations. ... Krivonozhko V. E., F rsund F. R., Lychev A. V. Some Ulterior Effects in the DEA models // Abstracts of the INFORMS Annual Meeting. ...
... On-line консультант . ... Место работы, должность: Преподаватель, старший научный сотрудник Лаборатории Вычислительных комплексов ВМК МГУ имени М.В.Ломоносова . ... D. Gamayunov, R. Smeliansky. ... 2002. (in Russian) . D. Gamayunov, A. Kachalin. ... In proceedings of the fifth Russian Applied and . ... detectors of computer attacks for corporate networks. ... I. Bulgakov, D. Gamayunov, E. Toroschin, Detecting network worms . ... Опыт работы по тематике магистратуры: 9 лет (руководство . ...
www.vovr.ru 1992 14 · 1 0 , 20 12 CHUCHALIN A., GERASIMOV S. THE COMPETENCES OF ENGINEER ING PROGRAMS GRADUATES: NATIONAL AND INTERNATIONAL STANDARDS The issues of modernization of criteria used by Association of Engineering Education of Russia i n public accreditation HEI's engi neeri ng education programs ar e analyzed in the paper. ... Key word s: Russian higher professional educati on reform, federal state educatio nal standards (FSES), FSES based HEI's undergraduate educational programs. ...
[
Текст
]
Ссылки http://www.umo.msu.ru/docs/projects/monitoring/eksp_analiz_oop_10_12.pdf -- 175.9 Кб -- 01.04.2013 Похожие документы
Call for Papers September 26-30, 2016 National Cultural Center "Minsk", Minsk, Belar us ICONO/LAT 2016 Int' l Conference on Coherent and Nonlinear Optics (ICONO 2016) Int' l Conference on Laser s, Applications, and Technologies (LAT 2016) The leading event in the area of quantum electronics, laser physics, photonics and their applications. ... Russia Vladimir Belyi, Stepanov Inst. of Physics, NASB, Belar us ICONO Program Vice-Chairs Yulia Vladimirova, Lomonosov Moscow State Univ., ...
[
Текст
]
Ссылки http://iconolat16.phys.msu.ru/download/icono-lat-2016-fcp-reduced.pdf -- 656.9 Кб -- 29.01.2016 Похожие документы
... CUDA Center of Excellence | MSU . ... Lomonosov Moscow State University (MSU) was awarded an NVIDIA CUDA Center of Excellence (CCOE) in 2011 for being one of the first Russian universities to recognize the importance of emerging GPU technologies and first to embrace CUDA. ... Lomonosov Moscow State University (MSU) is renowned as one of the leading computer science centers excelling in application of computational resources to address most vital scientific problems. ...
... Electronic journal Issue 4. 10 september 2004 Bonham G.M., Surin A. IP Videoconferencing in Graduate Professional Education: Collaborative Learning for Public Management Introduction. ... While technology offers a range of opportunities that a standard «chalk and talk» class could never match, questions about the educational value of the new digital media loom large. ... If so, how can technology more effectively promote student-centered learning? ... Collaborative IP Videoconferencing. ...
[
Текст
]
Ссылки http://e-journal.spa.msu.ru/uploads/vestnik/2004/vipusk_4._sentjabr_2004_g./bonham_surin.pdf -- 94.8 Кб -- 06.07.2014 Похожие документы
Ботанический сад Московского Государственного Университета им. М.В. Ломоносова Российское Общество Ириса Задачи Международного сотрудничества ирисоводов (Тезисы докладов) Москва 2005 Посвящается: 250-летию Московского Государственного Университета имени М. В. Ломоносова и 300-летию Ботанического сада Московского Государственного университета Тезисы докладов Международного Симпозиума «Задачи международного сотрудничества ... Ирисы, как объект исследования. ...
[
Текст
]
Ссылки http://www.botsad.msu.ru/docs/simp.doc -- 828.5 Кб -- 30.08.2010
[
Текст
]
Ссылки http://botsad.msu.ru/docs/simp.doc -- 828.5 Кб -- 30.08.2010 Похожие документы
... Русский English . Background . ... The Faculty of Bioengineering and Bioinformatics, Lomonosov Moscow State University was founded in 2002 with the express purpose of training of highly qualified personnel for the universities, research institutes, medical companies and facilities, and pharmaceutical and biotechnology industries. ... Each of FBB students is to successfully complete and defend three yearly research projects, in bioinformatics, biochemistry, and bioengineering. ...
... Если вы заинтересованы участвовать в работе Симпозиума, мы просим вас направить по электронной почте в адрес Оргкомитета (motility2006@iteb.ru) заполненные регистрационные формы до 1 февраля 2006 года и направить ваши тезисы до 15 марта 2006 года. ... Тезисы должны быть присланы по электронной почте вложенным файлом (предпочтительно) по адресу motility2006@iteb.ru или на дискете по адресу 142290, Институт теоретической и экспериментальной биофизики РАН, г. Пущино, Московской обл., ...
SIDA training in Sweden . Arthur R.Lyandzberg, Inna A.Novikova 22 февраля 2002 00:17:15 . ... Sida Country info Sector info Publications Training Programmes . ... Environment . Local Environment Management . ... Land Administration Geographical . ... Urban Land Management . ... Integrated Water Resources Management . ... Operational Hydrology, Technology Management . ... Contents:Hydrological problems, water management and general hydrology . Authorities, legislation and policies . ...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
... Публикации 2015 года . ... 2563496, 25 августа 2015 г. Тезисы докладов: . ... Москва: ЦИАМ им. П. И. Баранова, 2015. ... Волны в вязкоупругом слое, расположенном под слоем движущейся жидкости // Тезисы докладов VIII международной конференции 'Лаврентьевские чтения по математике, механике и физике'. ... Публикации 2014 года . ... Секция механики. 14 - 23 апреля 2014, Москва, МГУ имени М. В. Ломоносова. ... Публикации 2013 года . ... Секция механики. 15-23 апреля 2013, Москва, МГУ имени М.В.Ломоносова...
... UHECR SINP MSU . ... TUS . JEM-EUSO . mini-EUSO (UV atmosphere) . News . ... Lab's news . ... JEM-EUSO Extreme Universe Space Observatory on the Japanese Experiment Module (JEM) of the International Space Station . ... mini-EUSO and EUSO-SPB Progress Meeting . ... The 18th International JEM EUSO Collaboration Meeting . The 18th International JEM EUSO Collaboration Meeting held in Stockholm from 7 to 11 December 2015. ... 18th International JEM EUSO Collaboration Meeting . ...
SWEN ] [ events ] [ conferences ] [ Institutes ] [ Initiatives ] [ Groups ] [ data bases ] [ models ] . Space Weather Euro News (SWEN) [top] . ... Skobeltsyn Institute of Nuclear Physics Moscow State University (SINP MSU) . Space Research Institute (IKI) . ... Pulkovo Astronomical Observatory, Department of Solar Physics . ... Institute of Solar-Terrestrial Physics (RAS Siberian Division) . ... Chines Space Weather Initiatives (Space Weather Research in China and Introduction of CSSAR) . ...