... A comparative study of thermodynamic for both natural and artificial RNA/DNA protein complexes would establish bases for a specificity of complex formation. In particular, we have shown that aptamers could be used for a direct measuring of thrombin enzymatic activity in a solution. D 2002 Published by Elsevier Science B.V. Keywords: RNA/DNA protein interactions; Ribosome; SELEX; RNA/DNA aptamers; Thrombin; Enzymatic activity 1. ... The aptamer binds to the protein with Kd = 0.5 nM. ...
[
Текст
]
Ссылки http://rnp-group.genebee.msu.su/pdfs/article_vas_bioelectro.pdf -- 140.7 Кб -- 21.10.2002
[
Текст
]
Ссылки http://rnp-group.genebee.msu.ru/pages/pdf/bioelectro2002.pdf -- 140.7 Кб -- 18.02.2008 Похожие документы
, JavaScript : ..-.. .. : .., .., .., Samsung Research & Development Institute, Russia W orld W ide W eb JavaScript, W eb-. Web-, («Internet of Things») Web- , JavaScript , . , . JavaScript . 17.00 18.30 507. 10 2014. , , : jsseminar@outlook.com
... International Relations in Context of Global Processes - 17| ... GLOBAL ECONOMIC AND POLITICAL TRENDS Prof. Olga Y. Kornienko Economic literature survey Week 1 (4 academic hours ) 1) Current trends of global economy Week 2 (4 academic hours ) 2) Migration, population and globalization Week 3 (4 academic hours ) 3) Corporate culture and management: new trends Week 4 (4 academic hours ) 4) Development markets in global environment Week 5 (4 academic ... Models of the global world. ...
[
Текст
]
Ссылки http://www.msu.ru/en/admissions/general-programs/docs/FACULTY%20OF%20GLOBAL%20STUDIES.pdf -- 1512.1 Кб -- 23.03.2016
[
Текст
]
Ссылки http://fgp.msu.ru/wp-content/uploads/2014/06/Academic-Guide-for-FGS-MSU.pdf -- 1512.1 Кб -- 27.06.2014 Похожие документы
... Вы находитесь на сайте кафедры теоретической физики физического факультета МГУ им. М.В. Ломоносова. Здесь Вы можете получить разнообразную информацию о сотрудниках, читаемых курсах лекций, познакомиться с историей кафедры. О кафедре . ... Кафедра теоретической физики физического факультета МГУ им. М.В. Ломоносова, 2006 ...
Yakubovich (i) Professional preparation Olga Yakubovich 1967 1973 1973 1978 1996 (ii) Appointments MS in Geochemistry (cum laude), Moscow State University , Russia PhD in Crystallography and Crystal physics, Moscow State University , Russia Dr of Science in Geology and Mineralogy, Moscow State University , Russia 1997 present 1994 1997 1983 1994 1973 - 1983 Department of ...
Call for Papers September 26-30, 2016 National Cultural Center "Minsk", Minsk, Belar us ICONO/LAT 2016 Int' l Conference on Coherent and Nonlinear Optics (ICONO 2016) Int' l Conference on Laser s, Applications, and Technologies (LAT 2016) The leading event in the area of quantum electronics, laser physics, photonics and their applications. ... Russia Vladimir Belyi, Stepanov Inst. of Physics, NASB, Belar us ICONO Program Vice-Chairs Yulia Vladimirova, Lomonosov Moscow State Univ., ...
[
Текст
]
Ссылки http://iconolat16.phys.msu.ru/download/icono-lat-2016-fcp-reduced.pdf -- 656.9 Кб -- 29.01.2016 Похожие документы
... Voronin А. Каrmanov D. Savin А. Electronic engineer: . ... Engineer ? ... Electrical design of microprocessor systems, creating software for control and monitoring earth and satellite stations. ... Programming, electrical and layout design of test equipment for testing the silicon matrix for experiment ATIC (Advanced Thin Ionization Calorimeter), creating software for calibration. Electrical design of readout electronics, creating software for collecting and analysis data for experiment NUCLEON . ...
Nuclear Instruments and Methods in Physics Research B 161±163 (2000) 758±761 www.elsevier.nl/locate/nimb Yellow , red and blue pigments from ancient Egyptian palace painted walls M. Uda a a,b,* , S. Sassa a, S. Yoshimura c, J. Kondo d, M. Nakamura e, Y. Ban a, H. Adachi f Department of Materials Science ... Technology Research Institute, Tokyo, Japan f Department of Materials Science and Engineering, Kyoto University, Kyoto, Japan Abstract Yellow , ... Instr. and Meth. in Phys. Res. ...
. Laboratory Head: L.K.Gladilin, tel: (+7 495) 939 3568 , fax: (+7 495) 939 3064 , . Сотрудники Лаборатории (LHPR staff) . Web-pages: . L.K.Gladilin , . V.I.Rud , . I.A.Korzhavina , . Information for our Guests . Справка о создании и первом периоде работы лаборатории, подготовленная в 1980 г. Research Activities: . Scientific Information Search Engines : inSPIRE , ScienceResearch , Google Scholar . Scientific Servers : Interactions , AIP , Elements , Scientific . Feedback: Last modified on March 1, 2016.
... Кафедра системного анализа ВМК МГУ . ... О кафедре . ... на кафедру . ... ВМК . МГУ . ... СМУ ВМК . ... Alexandr Borisovich Kurzhanski) . In Russian . ... Kurzhanski was Elected Associate Member of USSR Academy of Sciences (now changed to Russian Academy of Sciences) in 1981 and Full Member in 1990. He is the Chairman of the Russian National Committee on Automatic Control (the IFAC NMO). ... Chairman of Russian National Committee of Automatic Control. ... 4 (8). pp. 100-118. (in russian). ...
... Opening of the educational programme - School of CEOs, "Capsule of security" for the key managers of Bashneft Group. 2013/04/02 - 4:30pm . ... Shmeleva Elena Vladimirovna . ... Research interests - strategic and corporate governance, culture of innovation, HSE-management, talent management, corporate social responsibility, quality management system of higher education. ... The head of more than 200 research projects. ... MSU website . ... 2006-2016 MSU Higher School of Management and Innovation. ...
Nanoterrorism: New Responsibility for Our World and Future in the Global TechnoScience Vitaly G. Gorokhov Institute for Philosophy of the Russian Academy of Sciences, Institute of Technology Assessment and Systems Analysis of the Research Center Karlsruhe (Germany) Vitaly.Grorokhov@itas.fzk.de "Bioterrorism and chemical warfare are not unthinkable. ... 2] But these conditions do not else exist for the time being in nanoscience and nanotechnology. ...
[
Текст
]
Ссылки http://www.iisi.msu.ru/UserFiles/File/bayern2009/gorokhov_eng.doc -- 45.5 Кб -- 02.04.2012
[
Текст
]
Ссылки http://www.ipib.msu.ru/UserFiles/File/bayern2009/gorokhov_eng.doc -- 45.5 Кб -- 02.04.2012
[
Текст
]
Ссылки http://iisi.msu.ru/UserFiles/File/bayern2009/gorokhov_eng.doc -- 45.5 Кб -- 02.04.2012 Похожие документы
... Department of Mathematical Physics . ... Springer: Журналы . Springer: Книги . ... Журнал Science . ... Журналы American Physical Society . ... Журналы NPG (Nature Publishing Group) . ... Журналы The American Mathematical Society . Журналы The Royal Society Publishing . ... The Royal Society Publishing (GreatBritain) . ... the Royal Society A: Mathematical, . ... the Royal Society B: Biological Sciences . Proceedings of the Royal Society A: Mathematical, Physical & Engineering Sciences . ...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
... Студенческая Астрономическая обсерватория ГАИШ . ... Любителям астрономии . ... Структура ГАИШ : Отдел внегалактической астрономии : . ... The head of the group was born on October the 3rd, 1941 in the Yaroslavl' region of Russia and twenty-three years later graduated from the Faculty of Physics in the Moscow State University. ... 1989), Professor of astrophysics and stellar astronomy at the Faculty of Physics in MSU (1990). ... 2005, Astronomy Letters, 31 , 160 . ... chernin@sai.msu.ru . ... Staff ...
... О кафедре . English . ... Department for Jewish Studies of Lomonosov Moscow State University . ... The Department for Jewish Studies (DJS) was established in 1998. ... The students take courses offered by the School (the Institute of Asian and African Studies), as well as courses offered by the Jewish Studies Department. ... The Department regularly accepts university teachers of Jewish and Israeli Studies from Russia and the FSU in order to upgrade their professional level. ...
... 1998 1 : Defended the Doctorate Degree Thesis on "Models of Cosmic Ray Particle Fluxes (Development and Applications)". ... Space Weather . ... Nymmik R.A., Radiation Environment Induced by Cosmic Ray Particle Fluxes in International Space Station Orbit According to Recent Solar and Galactic Cosmic Ray Models, Adv. ... Nymmik R.A., Radiation Environment Induced by Cosmic Ray Particle Fluxes in International Space Station Orbit According to Recent Solar and Galactic Cosmic Ray Models, Adv.Space Res. ...
INTERNATIONAL CONFERENCE HYDRODYNAMIC INSTABILITY AND TURBULENCE February 26 - March 05, Moscow, Russia ORGANIZED by Moscow State University, Institute of Mechanics of MSU and Faculty of Mechanics and Mathematics. ... SPONSORED by Russian Foundation for Basic Research, Moscow State University, Institute of Mechanics of MSU. ... Prospective participants must send abstracts in Word to the Organizing Committee (gertsens@imec.msu.ru) not later than 15 January 2006. ... Phone, E-mail and Fax number. ...
... Кафедра нелинейных динамических систем . ... В понедельник, 11 апреля 2016 г., в 18 ч 20 мин, в ауд. 707 состоится очередное заседание семинара. ... Автор: Фурсов Андрей Серафимович 09.04.2016 . В понедельник, 28 марта 2016 г., в 18 ч 20 мин, в ауд. 707 состоится очередное заседание семинара. ... Сотрудники кафедры НДСиПУ, участвующие в 2016 г. в экзаменационной комиссии - Боресков А.В., Краев А.В., Бобылева О.Н., Гончаров О.И., Капалин И.В. Автор: Фурсов Андрей Серафимович 22.02.2016 . ...