... One of the project objectives was to investigate practical efficiency of some modern iterative methods, including multigrid techniques and domain decomposition methods as well as methods for small compressible materials. ... Hence, the project research initiated because of INTAS financial support contributes in setting up modern computational techniques in tire design. ... Research on efficiency of iterative methods was conducted at the department of Mechanics of Composites about ten years ago. ...

Еще в разделе: (Показать все результаты (>4) - composite.msu.ru/ )

• INTAS 95-525 Project Main Page
• Department of the Composites Mechanics

Заведующий кафедрой Head of the Chair . ... История кафедры . ... В 1966 г. для расширения ведущихся на кафедре научных работ в НИИ Ядерной физики МГУ был создан отдел физики плазмы (ОФП), в 1989 году переименованный в отдел микроэлектроники (ОМЭ). ... Сегодня по различным научным направлениям, ведущимся по специальностям, преподаваемым на кафедре атомной физики, физики плазмы и микроэлектроники, работает около 100 научных сотрудников, среди которых 12 докторов наук и около 50 кандидатов наук. ...

Еще в разделе: (Показать все результаты (>2) - www.affp.mics.msu.su/ )

Guide to Market Research and Analysis Canada Business Service Centres - CBSCs Last Verified: 2004-11-08 Document No. 4013 Summary Successful businesses have extensive knowledge about their customers and their competitors. ... Market Analysis Who is your customer? ... Product or service focus must be the customer. ... The information will assist in determining business size (output requirements), distribution channels, pricing, promotion strategy and other marketing decisions. ...

Еще в разделе: (Показать все результаты (>33) - innovation.msu.ru/ )

• Start-Up Company Development :: Управление инновационной политики и организации

... 8 DOI: 10.1093/nar/gkh583 Mapping of the second tetracycline binding site on the ribosomal small subunit of E.coli Maria M. Anokhina1, Andrea Barta2, Knud H. Nierhaus3, Vera A. Spiridonova4 and Alexei M. Kopylov1,4,* Department of Chemistry ... University, 119992 Moscow, Russian Federation Received February 5, 2004; Revised March 22, 2004; Accepted April 14, 2004 1 ABSTRACT Tetracycline blocks stable binding of aminoacyltRNA to the bacterial ...

Еще в разделе: (Показать все результаты (>6) - rnp-group.genebee.msu.ru/ )

• http://rnp-group.genebee.msu.su/pdfs/febsz.pdf
• http://rnp-group.genebee.msu.ru/pages/pdf/biochem2003.pdf
• http://rnp-group.genebee.msu.ru/pages/pdf/biochem2002_1.pdf

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>5) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search
• About

... mechanic . ... engineer . ... senior researcher . ... 77 (floor -1) . ... Fedoseev Anatoly Ivanovich . docent . ... spekl@phys.msu.ru . ... Hlystov Vladimir Ivanovich . ... Ivanov Sergey Nikolaevich . leading engineer . 939-31-69 . sni@opts.phys.msu.ru . ... iak@opts.phys.msu.ru . ... Kolobanov Vitaly Nikolaevich . ... 2-07 (SINP MSU) . ... korolenko@optics.npi.msu.su . ... junior researcher . ... researcher . ... researcher (SINP MSU) . ... 71 (floor -1), 4-13(SINP MSU) . ...

Еще в разделе: (Показать все результаты (>2) - opts.phys.msu.ru/ )

Alexander S. Antonov . ... M.V.Lomonossov Moscow State University . ... June 4, 1999, Moscow State University . ... 1994-2000: programmer, Laboratory of Parallel Information Technologies, Research Computer Center, Moscow State University . ... A.S. Antonov, A.M. Teplov. ... Antonov A.S., Voevodin Vl.V., Sobolev S.I., Filamophitskiy M.P. Internet-Auditorium of Lomonosov Moscow State University // Abstracts of the All-Russian scientific conference "Scientific Services Internet" (Novorossiysk, 2000). ...

Еще в разделе: (Показать все результаты (>8) - asa.guru.ru/ )

... Likert-type scale response anchors. ... Level of Acceptability . ... Neutral . ... Level of Appropriateness . ... Level of Importance . ... Level of Agreement . ... Somewhat disagree . ... Somewhat agree . ... Never true . ... Rarely true . ... Sometimes but infrequently true . ... Sometimes true . ... Usually true . ... Always true . ... Somewhat true of me . ... Somewhat true of what I believe . ... Priority: . ... Somewhat priority . ... Priority Level . ... satisfied . ... Somewhat satisfied . ...

Еще в разделе: (Показать все результаты (>2) - tukachev.flogiston.ru/ )

... Improvement of Java type compiler using in language independent remote process calls in KBase project. 09/2011 ­ present: Moscow State University, Dept. of Bioengineering and Bioinformatics (Russia) Scientific Research Java developer and lecturer Enhanced the CAMPS web resource (http://webclu.bio.wzw.tum.de/CAMPS2.0/) that enables multiple classification of transmembrane proteins. ... Developed web based UI for visualization of a graph of transmembrane protein families. ... Sutormin RA, Mironov AA. ...

Еще в разделе: (Показать все результаты (>10) - storage.bioinf.fbb.msu.ru/ )

... The Department of Operations Research . April 9, 2016 . Welcome Traditional topics of the conference Important dates Abstracts Registration . ... dedicated to the outstanding Russian scientists . ... Moscow, April 10-14, 2007 Welcome . ... Dorodnicyn Computing Center of RAS, Computational Mathematics and Cybernetics Faculty of the M.V.Lomonosov Moscow State University and Russian Scientific Operations Research Society will organize the Vth Conference in April 2007 in Moscow. ...

Еще в разделе: (Показать все результаты (>12) - io.cs.msu.ru/ )

• Contacts - ORM 2007
• Abstracts - ORM 2007
• Accommodation - ORM 2007

... 11:00-11:30 Break 11:30-12:00 Lecture 3 Prof . Heinz Oberhammer , Institute of Physical and Theoretical Chemistry , University of Tubingen, Germany Structures and Conformations of Disilacyclohexanes 12:00-12:30 Lecture 4 Prof . Ingvar Arnason , University of Iceland, Iceland Energetics and Potentional Energy Surfaces of Disilacyclohexanes 12:30-13:00 Lecture 5 Prof . Igor Godunov, Chemistry Department , MSU , ...

Еще в разделе: (Показать все результаты (>4) - ged.chem.msu.ru/ )

... USA Today Sports . ... cheap ralph lauren . ... ralph lauren sale uk . ... 2016 С Днем Победы! ... win 7 ultimate product key Windows 8 key windows 7 key win 7 key windows 7 pro product key win 7 pro product key windows 7 activation key windows 7 ultimate product key windows 7 ultimate serial key windows 7 key online win 7 ultimate key win 7 serial keys Win 7 ultimate key Win 7 ultimate product key windows 7 key sale win 7 ultimate product ...

Еще в разделе: (Показать все результаты (>35) - elana.sinp.msu.ru/ )

... C1 [Sponer, Jiri] Acad Sci Czech Republic, Inst Biophys, CS-61265 Brno, Czech Republic. ... RP Sponer, J (reprint author), Acad Sci Czech Republic , Inst Biophys, Kralovopolska 135, CS-61265 Brno, Czech Republic EM sponer@ncbr.chemi.muni.cz golovin@belozersky.msu.ru FU Russian Foundation for Basic Research[11-04-02084-a]; Ministry of Education and Science of Russian Federation[16.512.11.2009]; Russian Academy of Sciences ; Grant Agency of the Academy of Sciences of the Czech...

Еще в разделе: (Показать все результаты (>13142) - dualopt1.cmm.msu.ru/ )

• %TOPICTITLE% (18 vs. 19) - TWiki
• WebHome - Projects - TWiki - (printable)
• WebHome - Projects - TWiki

. Laboratory Head: L.K.Gladilin, tel: (+7 495) 939 3568 , fax: (+7 495) 939 3064 , . Сотрудники Лаборатории (LHPR staff) . Web-pages: . L.K.Gladilin , . V.I.Rud , . I.A.Korzhavina , . Information for our Guests . Справка о создании и первом периоде работы лаборатории, подготовленная в 1980 г. Research Activities: . Scientific Information Search Engines : inSPIRE , ScienceResearch , Google Scholar . Scientific Servers : Interactions , AIP , Elements , Scientific . Feedback: Last modified on March 1, 2016.

Еще в разделе: (Показать все результаты (>4) - lhe.sinp.msu.ru/ )

• Information for our Guests
• L.Gladilin's address Page

license ]] . CompHEP . Trace: license . ... This Licence entitles the Licensee (one person) and the Licensee 's research group to obtain a copy of the source or executable code of CompHEP and/or interfaces of CompHEP to other Monte-Carlo generators and to use the acquired program for academic research or other non-profit purposes within a research group; or, it entitles the Licensee (a company, organisation or computing center) to install the ... CompHEP team . ...

Еще в разделе: (Показать все результаты (>18) - comphep.sinp.msu.ru/ )

• contacts [CompHEP]
• news [CompHEP]
• tutorials [CompHEP]

... Currently there are 27 faculties - of Mechanics and Mathematics, Computational Mathematics and Cybernetics, Physics, Chemistry, Geology, Biology ... Sociology, Institute of Asian and African Studies, Public Administration and Social Studies, Materials Sciences, Pedagogy, Arts, International Relations, Bioengineering and Bioinformatics, Continuing Education , Center for International Education The total number of students including post-graduates is currently 40,000. ...

Еще в разделе: (Показать все результаты (>11) - www.ied.msu.ru/ )

• International Office of Moscow University - Foreign partners
• International Office of Moscow University - Programs and degrees

... COMMONWEALTH OF INDEPENDENT STATES (CIS) CHAPTER . ... Dept. of Chemistry, Lomonosov Moscow State university, Leninskie Gory, 119992 Moscow, Russia . ... Dept. of Chemistry, Lomonosov Moscow State University, Leninskie Gory, 119992 Moscow, Russia . ... Danchenko Natalya Nikolaevna, Dr. Dept. of Geology, Lomonosov Moscow State University, Leninskie Gory, 119992 Moscow, Russia . ... 7(095)2308037 . ... Dept. of Physics, Lomonosov Moscow State University, Leninskie Gory, 119992 Moscow, Russia . ...

Еще в разделе: (Показать все результаты (>4) - www.mgumus.chem.msu.ru/ )

• MGUMUS -- Matvey V. Youdov
• MGUMUS -- Anna N. Bolkova
• MGUMUS -- Ekaterina A. Ilyukhina

NANO AND GIGA CHALLENGES IN MICROELECTRONICS: RESEARCH OPPORTUNITIES IN RUSSIA . ... Moscow, September 11-13, 2002 . This meeting will bring together scientists and engineers from academia, industry and national labs to discuss recent developments, and explore potential for collaboration solving the most challenging scientific and engineering problems in microelectronics. ... atomic scale design: theory and experiment . highest frequency electronics . ... non-silicon materials and devices . ...

Еще в разделе: (Показать все результаты (>30) - genphys.phys.msu.su/ )

• Публикации

Вы посетили: inv_engl.html . ... История кафедры . ... Visiting Professor at the University of Oslo, Norway, Oslo, November, 2010 . ... Visiting Professor at the University of Ljubljana, Slovenia, August, June 2010 . ... Visiting Professor at the University of Patras and the University of Athens, Greece, June-July 2009 . ... Visiting Professor at the University of Stockholm, Sweden, January ? ... staff/guterman/inv_engl.html.txt Последние изменения: 13.02.2013 11:26 (внешнее изменение) | ...

Еще в разделе: (Показать все результаты (>16) - halgebra.math.msu.su/ )

• staff:guterman:int_engl.html | Кафедра высшей алгебры
• staff:guterman:grants_engl.html | Кафедра высшей алгебры
• staff:guterman:activ_rus.html | Кафедра высшей алгебры