... From neurons to behaviour: Context representation and memory reconsolidation in the entorhinal hippocampal system Panel LS5 LS9 LS7 LS8 LS8 LS3 LS5 LS2 LS5 LS2 LS1 LS6 LS3 LS5 LS6 LS2 LS9 LS2 LS7 LS9 LS6 LS8 LS5 LS3 LS2 LS1 LS5 Last Name ADAMANTIDIS ALFONTA ALIMONTI BALABAN BALLOUX BETTENCOURT DIAS BINSHTOK BISCHOFS-PFEIFER BISHOP BLANDIN BOISBOUVIER BOUSSO ... Understanding epigenetic mechanisms of complex genome editing in eukaryotes. ...

Еще в разделе: (Показать все результаты (>24) - ideas.msu.ru/ )

• http://ideas.msu.ru/news/19_10_2010/Results_PE.pdf
• http://ideas.msu.ru/news/19_10_2010/Results_country.pdf

... Antal , T.K., Volgusheva , A.A., Kukarskih , G.P., Krendeleva , T.E., Rubin, A.B. Relationships between H 2 photoproduction and different electron transport pathways in sulfur-deprived Chlamydomonas reinhardtii (2009) International Journal of Hydrogen Energy, 34, pp. ... Antal , T.K., Volgusheva , A.A., Kukarskikh , G.P., Krendeleva , T.E., Tusov , V.B., Rubin, A.B. Examination of chlorophyll fluorescence in sulfur-deprived cells of Chlamydomonas reinhardtii (2006) Biofizika ., 51 (2), pp. ...

Еще в разделе: (Показать все результаты (>6) - biophys.msu.ru/ )

... Квантовая теория . ... Непертурбативная низкоэнергетическая физика адронов и лептонов (руководители - проф. К.А.Свешников, проф. А.Е.Дорохов). ... Методы квантовой теории поля в физике конденсированного состояния (руководители - с.н.с. О.В.Павловский, с.н.с. М.В.Улыбышев). Кафедра активно участвует в организации и проведении ежегодных международных семинаров по проблемам квантовой теории поля и теории гравитации в ИФВЭ - Протвино. ... Phys. Rev. D 85 (2012) 094022, arXiv: 1110.6059. ...

Еще в разделе: (Показать все результаты (>29) - hep.phys.msu.ru/ )

... 1998 1 : Defended the Doctorate Degree Thesis on "Models of Cosmic Ray Particle Fluxes (Development and Applications)". ... Space Weather . ... Nymmik R.A., Radiation Environment Induced by Cosmic Ray Particle Fluxes in International Space Station Orbit According to Recent Solar and Galactic Cosmic Ray Models, Adv. ... Nymmik R.A., Radiation Environment Induced by Cosmic Ray Particle Fluxes in International Space Station Orbit According to Recent Solar and Galactic Cosmic Ray Models, Adv.Space Res. ...

Еще в разделе: (Показать все результаты (>7) - srd.sinp.msu.ru/ )

... The two main ways of financing a business, equity financing and debt financing, will be discussed in this chapter. Equity Financing Equity capital is the amount of money that you and/or your partners put into the business or raise from other investors. Equity is not debt. While investors share in the profits (or losses) of the business, their investment is not a loan. ... Debt Financing With your equity capital in place, you are now in a position to approach lenders for a business loan. ...

Еще в разделе: (Показать все результаты (>29) - innovation.msu.ru/ )

• Создание инновационной компании :: Управление инновационной политики и

... 1) A. Goryunkov, E. Dorozhkin, D. Ignat eva, L. Sidorov, E. Kemnitz, G. Sheldrick, S.Troyanov. ... 2) E.I. Dorozhkin, D.V. Ignat`eva, N.B. Tamm, A.A. Goryunkov, P.A. Khavrel, I.N. Ioffe, A.A. Popov, I.V. Kuvychko, A.V. Streletskiy, V.Yu. ... Chem. ... 4) D.V. Ignat`eva, A.A. Goryunkov, N.B. Tamm, I.N. Ioffe, S.M. Avdoshenko, L.N. Sidorov, A. Dimitrov, E. Kemnitz, S.I. Troyanov. ... 6) S.M. Avdoshenko, A.A. Goryunkov, I.N. Ioffe, D.V. Ignat`eva, L.N. Sidorov, P. Pattison, E. Kemnitz, S.I. Troyanov. ...

Еще в разделе: (Показать все результаты (>59) - thermolab.chem.msu.ru/ )

... Keywords: boundary-layer depth, stable stratification, Ekman layer. ... Experimental data (23) Data sets used in this paper for empirical validation of the proposed SBL depth formulation are taken from three measurement sites ( Figure 1), namely, (i) Cabauw measurement station (Nieuwstadt, 1984; Van Ulden and Wieringa, 1996), (ii) BASIS (Baltic Air-Sea-Ice Study) field experiment (Launiainen, 1999), and (iii) ETH-Greenland expedition in summer 1991 (Ohmura et al., 1992). (i) Cabauw ...

Еще в разделе: (Показать все результаты (>11) - geophys.srcc.msu.ru/ )

• http://geophys.srcc.msu.ru/library/wind_stress.pdf

... Surface disturbance and deformat ion are shown in the same scale. Displac the free surface is much smoother as compared bottom deformations: init ial elevat ion has amplitude and spreads over a rather wide area. bottom theory, bottom ement of with the smaller F ­ velocity potential, H ­ depth, ­ vector of bottom deformation, 0 ­ initial elevation a . ... The init ial elevation assumed to be equal to the vertical bottom deformat ion (a); calculated with use of the Laplace smoothing algorithm (b). ...

Еще в разделе: (Показать все результаты (>17) - ocean.phys.msu.ru/ )

• Index of /courses/phys_tsu/lecture02/

Supercomputer consortium of Russia's universities creation A G R E E M E N T Under this Agreement - Moscow State Lomonosov University, - Nizhny-Novgorod State Lobachevsky University, - Tomsk State University, - South-Urals State University, referred hereinafter as "the Parties", have defined their arrangements on creation of Supercomputer consortium of Russia's universities 1. ... The full official name of the entity in Russian language is: Supercomputer consortium of Russia's universities. ...

Еще в разделе: (Показать все результаты (>32) - www.rsr-online.ru/ )

. Links . arXiv.org (Lanl gov) . Large amount of articles . http://arXiv.org . Scientific Electronic Library . http://www.elibrary.ru . Elsevier Science; Kluwer Academic Publishers; Springer Berlin Heidelberg . and others... Laboratory of Theoretical Nonlinear Dynamics in Institute of Radio-Engineering and Electronics of RAS, Saratov Branch IRE RAS . http://www.sgtnd.tserv.ru . Head of the group Doctor of Sciences, Professor Sergey P. Kuznetsov . Painter Andrey Isaev . http://www.IsaevArt.ru .

Еще в разделе: (Показать все результаты (>60) - chaos.phys.msu.ru/ )

• Research interests

... Vera A. Barinova Ph.D., Head of Laboratory for Corporate Strategies and Firm Behavior Studies, Institute of Applied Economic Research, Russian Presidential Academy of National Economy and Public Administration, Moscow, Russian Federation. ... The purpose of this paper is to systematize and summarize the results of recent research into the development of innovation companies on early stages of their existence. ... Innovation, early stages, discreteness of financing, factors of firm development. ...

Еще в разделе: (Показать все результаты (>28) - ee-journal.spa.msu.ru/ )

Second announcement VII Moscow International Conference on Operations Research (ORM2013) Moscow, October 15-19, 2013 Dear colleagues, we invite you to attend the VII Moscow International Conference on Operations Research. ... Information on important dates, registration and abstract submission. ... An extended abstract should be presented as a LaTex file in English language according to the attached template, and its volume should be three pages (or little less). ...

Еще в разделе: (Показать все результаты (>8) - io.cmc.msu.ru/ )

• Кафедра Исследования Операций

... Strike-slip magmatic duplexes . ... During 1996-1998 we have carried out a complex field and laboratory study of particular class of the geological objects, which we named strike-slip magmatic duplexes (SSMD), in limits of the Eastern Urals, Central Kazakhstan and Kola-Karelia region. ... 2) We recovered within the Eastern Urals a series of geological objects identidied as SSMD of different age and of different deepness, and studied them in detail due to field investigations. ...

Еще в разделе: (Показать все результаты (>10) - sbmg.geol.msu.ru/ )

• Photoalbums
• Calendar Converter

... A Primer from the Reform of Personal Income Taxation in Russia Introduction. ... However, to use the welfare function one needs to aggregate individual preferences that can also be unknown. ... The derivations lead to the conclusion that the optimal marginal income tax rate is increasing as the elasticity of labor supply increases. ... In this paper we obtain the characteristics of the labor supply for different population groups to get the elasticities of labor supply with respect to a post tax...

Еще в разделе: (Показать все результаты (>11) - e-journal.spa.msu.ru/ )

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>3) - mouse.genebee.msu.ru/ )

• StructAlign help

О кафедре . Наука . ... Главная -> Учебный процесс -> Спецкурсы -> Введение в геометрическую теорию управления -> Программа курса . Лекционные курсы . ... Кинематическая задача об управлении мобильным роботом. Возможные типы ограничений на управление. ... Larmond J.-P. (Ed.) Robot Motion Planning and Control. ... 2002. ... М.И. Зеликин, В.Ф. Борисов Синтез оптимальных управлений с накоплением переключений// ВИНИТИ. ... 2002 2016 Кафедра Оптимального управления факультета ВМиК МГУ . ...

Еще в разделе: (Показать все результаты (>14) - oc.cs.msu.ru/ )

... SUPER RATIO . ... On this page I will present the most important (on my opinion) idea on Intellegence Life in the Universe . ... On the problem of the Super Ratio in astrophysics" . ... As a matter of fact, this is the main problem of the modern natural science. ... Here I shall try to speak about the most important problem of the modern natural science, the problem which is undoubtedly, of more importance than discovery of Blacks Holes, creation of Grand Unification Theory or Artificial...

Еще в разделе: (Показать все результаты (>192) - www.pereplet.ru/ )

... Системы координат . ... Методы определения основных астрометрических постоянных. ... Методы абсолютных и относительных определений координат. ... Вывод фундаментальной системы звездных положений и собственных движений. ... Радиоастрономические методы определения координат объектов, неравномерности вращения Земли, движения полюсов и расстояний на поверхности Земли. ... Формальное интегрирование уравнений движения в элементах промежуточной орбиты методом малого параметра Ляпунова-Пуанкаре. ...

Еще в разделе: (Показать все результаты (>26) - aspirant.phys.msu.ru/ )

... N. Konev, D. N. Matorin, R. Hapter, and A. B. Rubin Moscow State University, Moscow, Russia Received February 12, 1998; in final form, November 18, 1998 Abstract--Vertical profiles of phytoplankton primary production (PP), chlorophyll a, and fluorescence measured near the surface in the central Baltic Sea in September 1995 featured similar variations related to the diurnal dynamics of solar radiation. ... Vertical profiles of the measured and calculated values of primary production. ...

Еще в разделе: (Показать все результаты (>37) - library.biophys.msu.ru/ )

• http://library.biophys.msu.ru/PDF/3347.pdf
• http://library.biophys.msu.ru/PDF/3340.pdf
• http://mgumus.chem.msu.ru/publication/2006/perminova-mediating.pdf

... справочник учебные материалы ссылки программы . ... Изучение механических свойств полимеров методом динамометрии [механика] (*.xls, 22 KB) . Кинетика кристаллизации полимера из расплава [структура] (*.xls, 23 KB) . ... Межмолекулярное взаимодействие типа матрица-полимер" (*.doc, 34 KB) . ... Синтез полимеров . ... Химические свойства полимеров . ... новости студенты преподаватели лаборатории интернет-олимпиада по химии . справочник учебные материалы ссылки программы дни химика . ...

Еще в разделе: (Показать все результаты (>85) - www.students.chemport.ru/ )

• Sr день химика 03
• День химика. 2005 год Цирконий.
• Лаборатории кафедры органической химии