... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>19) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/fasta.out

... О хоре . История хора . ... Выступление Академического хора МГУ в Крокус Сити Холле . ... Епископ Тихон открыл выступление хора МГУ в Вене . Хор МГУ выступил в Венском отделении ООН . Выступление хора на торжественном открытии Международного научного конгресса ?Глобалистика ? 2015? ... Академический хор Московского государственного университета имени М. В. Ломоносова . ... Прослушивания состоятся в течение всего сентябряљв 311 и 316 классах Культурного центра МГУ в 18-30 . ...

Еще в разделе: (Показать все результаты (>2) - choir.msu.ru/ )

... Полная версия этой страницы: Опрос для мужской части . Студенческий форум Физфака МГУ > Общий > Все обо всем > Мальчики-девочки . ... God is a girl, wherever you are, . Do you believe it, can you receive it, . God is a girl, whatever you say, . ... God is a girl, however you live, . ... God is a girl, she's only a girl, . ... 2ELANOR - ну да, ибо форум студенческий, а не ценителей пеггинга и не анонимная имиджборда с разделом "Извращения" (основные источники статистики для моего проекта). ...

Еще в разделе: (Показать все результаты (>528) - wasp.phys.msu.ru/ )

• Студенческий форум Физфака МГУ > и еще один новый журнал просит прислать статьи
• Студенческий форум Физфака МГУ > Новый журнал Call for Papers
• Студенческий форум Физфака МГУ > вопросы соискателя

BioSystems 46 (1998) 95 ­ 101 Time, reflectivity and information processing in living systems: a sketch for the unified information paradigm in biology Abir U. Igamberdiev * Department of Plant Physiology and Biochemistry Voronezh State Uni6ersity, 394693, Voronezh, Russia Abstract The recognition activity of biomacromolecules based on quantum non-demolition measurements is regarded as the basis of information processing. ... On conjugate complex time and information in relativistic quantum theory. ...

Еще в разделе: (Показать все результаты (>437) - chronos.msu.ru/ )

• http://temporology.bio.msu.ru/EREPORTS/igamberdiev_objective.pdf
• http://temporology.bio.msu.ru/EREPORTS/oleinik_the_problem.pdf
• Determination analysis as a method for diagnostics of ecosystem condition

... Master Education . Second Education . ... Entrance requirements . ... personal statement addressed to the rector of MSU, containing the post-graduate course title and masters? program name . ... All applicants for full-time course (Russian students, both on scholarship and contract) are subject to following examinations: . ... All applicants to evening courses take an oral examination in the field of expertise. ... Второе высшее образование: second_edu@cs.msu.ru, 6-й этаж, комната 640, тел. ...

Еще в разделе: (Показать все результаты (>20) - hcs.cmc.msu.ru/ )

... It was found that CNT-based filters are efficient for the adsorption of heavy metals from aqueous solution. DETERMINATION OF THE NI (Tl) DETECTOR EFFICIENCY USING RADIOACTIVE PARALLELEPIPED SOURCES Mohamed S. Badawi1), Mona M. Gouda1), Ahmed M. El-Khatib1), Mohamed A. Elzaher2), Abouzeid A. Thabet3), Ahmed A. Salim1) and Mahmoud I. Abbas1) 1) Physics Department , Faculty of Science, Alexandria University , 21511 Alexandria, Egypt , 2) Department of Basic and Applied Sciences, ...

Еще в разделе: (Показать все результаты (>100) - danp.sinp.msu.ru/ )

• http://danp.sinp.msu.ru/LIIWM/jap103(2008)07E738.pdf
• http://danp.sinp.msu.ru/LAS/Nimb254_jan07_200Shulga.pdf
• http://danp.sinp.msu.ru/Tulinov_85/physlett_tulin.pdf

О кафедре . ... Динамические задачи теории упругости . ... Математическая теория пластичности . Методы теории упругости . ... Нелинейная теория упругости . ... Прочность и разрушение материалов и элементов конструкций . ... Теория упругости структурно-неоднородных тел . ... Численные методы в теории упругости и пластичности . ... КАФЕДРА ТЕОРИИ УПРУГОСТИ . ... Математические модели, теория эксперимента; долговечность и прочность элементов ответственных конструкций из высоконаполненных полимеров. ...

Еще в разделе: (Показать все результаты (>2) - elast.math.msu.su/ )

... Музей . антропологии . ... Вестник МГУ Антропология . ... Серия XXIII. ... 125009, г. Москва, ул. Моховая, д. 11, НИИ и Музей антропологии МГУ, комн. ... Другим известным деятелем, оказавшим большое влияние на развитие отечественной антропологии, был профессор географии Московского университета Д.Н. Анучин. ... 2008-2010 Научно-исследовательский институт и Музей антропологии им.Д.Н.Анучина . Копирование материалов web-сайта только с разрешения администрации НИИ и Музея антропологии МГУ! ...

Еще в разделе: (Показать все результаты (>30) - www.anthropos.msu.ru/ )

... HOMETOPIC%][%HOMETOPIC%]] - try out Foswiki on your own * [[Sandbox.% TOPIC%Sandbox][%TOPIC%Sandbox]] - just for me * * ---++ My Personal Data Note: if personal data is being stored using a secret database, then it is only visible to the user and to administrators. ... My Personal Preferences Uncomment [[%SYSTEMWEB%.PreferenceSettings][preference settings]] to activate them (remove the #-sign). ... This topic: Main > WikiUsers > ArtemTimoshenko . ... Copyright by the contributing authors. ...

Еще в разделе: (Показать все результаты (>1648) - wiki.cs.msu.ru/ )

• (backlinks in System Web) ChangeEmailAddress < System < Foswiki
• (backlinks in all Webs) ChangeEmailAddress < System < Foswiki
• HistoryPlugin < System < Foswiki

... Faculty of Physics . ... Research Centers . ... Search Faculties Staff . Education . ... Any division Budget Depatment Center of Computer Physics (CCP) Center of Education Quality Control Center of Hydrophysical Studies Center of Information Systems and Technologies (CIST) Chair of Acoustics Chair of Astrophysics and Stellar Astronomy Chair of Atomic Physics , Plasma Physics , and Microelectronics Chair of Biophysics Chair of Celestial Mechanics, Astrometry, and Gravimetry ...

Еще в разделе: (Показать все результаты (>2) - phys.msu.su/ )

... Faculty of Physics . ... Divisions Chairs . ... Search Faculties Staff . Education . ... Any division Budget Depatment Center of Computer Physics (CCP) Center of Education Quality Control Center of Hydrophysical Studies Center of Information Systems and Technologies (CIST) Chair of Acoustics Chair of Astrophysics and Stellar Astronomy Chair of Atomic Physics , Plasma Physics , and Microelectronics Chair of Biophysics Chair of Celestial Mechanics, Astrometry, and Gravimetry ...

Еще в разделе: (Показать все результаты (>12) - www.phys.msu.ru/ )

• Giving to the Faculty

... Начало концерта в 19.00. ... 3 марта 2016 года в Мраморном фойе Культурного центра МГУ на Воробьевых горах состоится концерт органной музыки . ... Исполнители: участники Органного класса, Валерия Ринская (фагот). Начало концерта в 19.00, вход свободный. ... 17 ноября 2015 года в Мраморном фойе Культурного центра МГУ на Воробьевых горах состоится концерт органной музыки . ... 23 сентября 2015 года в Мраморном фойе Культурного центра МГУ на Воробьевых горах состоится концерт органной музыки . ...

Еще в разделе: (Показать все результаты (>3) - www.organ.msu.ru/ )

... Студенческая Астрономическая обсерватория ГАИШ . ... Любителям астрономии . ... Структура ГАИШ : Отдел внегалактической астрономии : . ... The head of the group was born on October the 3rd, 1941 in the Yaroslavl' region of Russia and twenty-three years later graduated from the Faculty of Physics in the Moscow State University. ... 1989), Professor of astrophysics and stellar astronomy at the Faculty of Physics in MSU (1990). ... 2005, Astronomy Letters, 31 , 160 . ... chernin@sai.msu.ru . ... Staff ...

Еще в разделе: (Показать все результаты (>18) - www.sai.msu.ru/ )

• Digitization of Moscow Plate Archives
• Uploading Files
• Moscow Astronomical Plate Archives: Contents, Digitization, Current and

... MSU Chamber Orchestra . ... Concerto МГУ . ... Georg Fridrich HANDEL . ... May 1 (Sunday), 6.00 p.m. Baptist Church in Zelenograd. buses 9, 11 or taxi 131 from metro station 'Rechnoj vokzal'. tel. ... May 2 (Monday), 6.00 p.m. Moscow Baptist Church 'Resurrection'. metro station 'Kashirskaja', Kashirskoe shosse, 70, bld. 2. tel . ... May 4 (Wednesday), 7.00 p.m. The 2 nd Moscow Baptist Church. metro stations 'Tulskaja' or 'Nagatinskaja', Varshavskoe shosse, 12 А . ... MSU CHAMBER ORCHESTRA . ...

Еще в разделе: (Показать все результаты (>25) - music.genebee.msu.ru/ )

• MSU Chamber Orchestra. Alia.

... Faculty of Basic Medicine, Lomonosov Moscow State University and State Research Center ­ Institute for Biomedical Problems, Russian Academy of Science invite you to take part in "VI Russian National School with International Participation on Muscle and Exercise Physiology "Systemic and cellular mechanisms in physiology of motor system". ... We invite scientists, post-grade students, residents and students to take part in School on systemic and cellular mechanisms in physiology of motor system. ...

Еще в разделе: (Показать все результаты (>22) - fbm.msu.ru/ )

• http://www.fbm.msu.ru/upload/news/2012/12-05/progr.doc

... Н айти друзей по учебе, договориться о встрече группы или курса, рассказать о себе и своей работе, разместить информацию о своей организации, поздравить соседа по университетской парте с днем рождения, обсудить общие проблемы - все это можно сделать в Клубе выпускников. ... З десь Вы можете найти информацию о любом зарегистрированном выпускнике МГУ, а также обновить информацию о себе или о тех, чей пароль Вы знаете. ... Экономический, 1999 . Биологический, 1999 . Биологический, 1986 . ...