... A new data acquisition system was implemented to allow us to handle the high data rates produced by the multiple triggers. ... The LGD system includes the 9 ton glass array of 4 cm x 4 cm x 45 cm blocks, a transporter capable of placing each module in an electron beam for calibration and a monitoring system. ... A unique feature of E852 is the ability to make a trigger decision based on either the total energy or the effective mass of a system of photons. ... First, the energy cluster must be narrow...

Еще в разделе: (Показать все результаты (>30) - lav01.sinp.msu.ru/ )

• http://lav01.sinp.msu.ru/nir/papers/NIM_2prot-LGD.pdf
• http://lav01.sinp.msu.ru/nir/papers/PRD72001.pdf
• http://lav01.sinp.msu.ru/nir/papers/IEEE_ASC_17_2_2007_1185_1190.pdf

... There are two main thrusts in the theory of regular and chiral p olytop es: the abstract, purely combinatorial asp ect, and the geometric one of realizations. ... The dimension of a faithful realization of a finite abstract regular p olytop e in some euclidean space is no smaller than its rank, while that of a chiral p olytop e must strictly exceed the rank. ... In E4 , therefore, the open cases are the (finite) chiral polytopes of rank 3, and the regular or chiral apeirotopes of ranks 3 and 4. ...

Еще в разделе: (Показать все результаты (>19) - dfgm.math.msu.su/ )

• Фоменко А.Т. / Кафедра Дифференциальной геометрии и приложений /
• Научная работа / Кафедра Дифференциальной геометрии и приложений /

... Carbon and Nitrogen As Resources Limiting the Growth of Mono- and Mixed Cultures of Pseudomonas aeruginosa Dissociants P. V. Fursovaa, E. S. Mil'kob, and A. P. Levichc c Department of Biophysics Department of Microbiology Department of General Ecology, Moscow State University, Moscow, 119991 Russia e-mail: fursova @biophys.msu.ru b a Received December 26, 2006 Abstract--New experiments for detection of resources limiting the ... 1997; Levich, 2000). ... 1) (Levich et al., ...

Еще в разделе: (Показать все результаты (>10) - dis.bio.msu.ru/ )

... CENTRE FOR PHOTONUCLEAR EXPERIMENTS DATA . Online Services | ... CDFE: Online Services . ... Coded (machine-retrievable) information . ... DATA . ... This appendix provides a listing of all information-identifier keywords, along with details about their use. ... The general format of the coding string consists of three major fields which may be preceded by a decay flag: ((decay flag)nuclide,half-life,radiation). ... Gives information on references that contain information about the data coded. ...

Еще в разделе: (Показать все результаты (>8) - cdfe.sinp.msu.ru/ )

PHYSICAL REVIEW A 73, 063810 2006 Polarization states of four-dimensional systems based on biphotons Yu. ... Another disadvantage of using polarization qutrits rises from the fundamental impossibility to switch between arbitrary qutrit states using SU 2 optical elements, like retardation plates, rotators, etc. ... II we discuss the main properties of ququarts that are generated using the polarization state of the two-photon biphoton field. ... That subset of states was used to be reconstructed. ...

Еще в разделе: (Показать все результаты (>57) - qi.phys.msu.ru/ )

• http://qi.phys.msu.su/papers/2006-prl-97-023602.pdf
• http://qi.phys.msu.ru/papers/2009-epl-87-10008.pdf
• http://qi.phys.msu.ru/papers/2010-prl-105-010404.pdf

МГУ имени М.В.Ломоносова Русская версия . ... Science calendar . ... Innovative natural resources management . ... Art Criticism and History . ... International Conference for Students and Young Scientists "Lomonosov" . ... 29 Feb 2016 . ... The members of C ouncil of experts : Bobyleva A.Z., Doctor of Economics, Professor; Volcov F.M., Doctor of Economics, Professor; Klementyev D.S., Doctor of Philosophy science, Professor; Koshkidko V . ... The history of management . ... МГУ имени М.В. Ломоносова . ...

Еще в разделе: (Показать все результаты (>12) - conf.msu.ru/ )

... Fluorescence induction curves registered from individual microalgae cenobiums in the process of population growth. ... Registration of chlorophyll fluorescence induction curves (IC) from individual microalgae cenobiums was performed during Scenedesmus quadricauda culture growth. ... Recording of the fluorescence induction curve for each individual cenobium was performed during 200 s. In the process of algae cultivation (52 days) 846 fluorescence kinetic curves were recorded. ...

Еще в разделе: (Показать все результаты (>13) - www.library.biophys.msu.ru/ )

... 2008. NONHOLONOMIC MECHANICS Gauss Principle and Realization of Constraints V. V. Kozlov* V.A. Steklov Institute of Mathematics, Russian Academy of Sciences, ul. ... From (3) it immediately follows that an actual motion is a virtual one. ... x (10) If one considers this relation as a definition of virtual motions, then the generalized Gauss principle leads to the equation x=- Е ,x x, (x, x) V x which also has the integral of energy, but differs from the initial equation (9). ...

Еще в разделе: (Показать все результаты (>88) - ics.org.ru/ )

• http://ics.org.ru/upload/iblock/250/188-an-extended-hamilton-jacobi-method_ru.pdf
• http://ics.org.ru/upload/iblock/336/170-statistical-irreversibility-of-the-kac-reversible-circular-model_en.pdf
• http://ics.org.ru/upload/iblock/650/122-kinetics-of-collisionless-continuous-medium_ru.pdf

... DEPRON device (Dosimeter of Electrons, PROtons and Neutrons) is intended for the measurements ofљ the absorbed doses and linear energy transfer spectra from high-energy electrons, protons and nuclei of space radiation, and for detecting of thermal and slow neutrons flux. ... Charged particles dosimeter based on semiconductor detector . ... For each detected particle an amplitude of impulse proportional to the energy lost by the particle in the detector?s track sensitive volume is registered. ...

Еще в разделе: (Показать все результаты (>16) - lomonosov.sinp.msu.ru/ )

• Mikhail Lomonosov ? the Pioneer of Russian Science | Университетский спутник

... Carbamide . ... Moscowљ? ... URALCHEM and Stamicarbon will develop a new technology for urea production . URALCHEM, a leading Russian producer of nitrogen fertilizers, signed a joint technology development agreement for the synthesis of urea with Stamicarbon, the world's top developer and licensor of urea processes. ... Laboratory of Chemical Thermodynamics љwasљestablished by Prof. Adam V. Rakovsky (corresponding member of USSR Academy of Sciences) first as a "halurgy laboratory" in 1930. ...

Еще в разделе: (Показать все результаты (>2) - td.chem.msu.ru/ )

... News . ... TLE news . ... Publications on Transient luminous events . ... The UHECRs will be detected through the measurement of the emission in the range between 290 and 430 nm, where some part of Transient Luminous Events (TLEs) emission also appears. ... Luminous event parameters (atmosphere altitude, energy released to radiation, and temporal pro?les) are similar to observed elsewhere parameters of transient luminous events (TLE) of elves, sprites, halo, and gigantic blue jets types. ...

Еще в разделе: (Показать все результаты (>11) - uhecr.sinp.msu.ru/ )

• Science of atmospheric phenomena with JEM-EUSO
• UV atmosphere (mini-EUSO) experiment onboard Russian segment of the ISS

Volume 163, number 2 FEBS 0973 November 1983 Diazepam inhibits cell respiration and induces fragmentation of mitochondrial reticulum Ivan A. Vorobjev and Dmitry B. Zorov A.N. Belozersky Laboratory of Molecular Biology and Bioorganic Chemistry, Moscow State University, 117234 Moscow, USSR Received 1 August 1983; revised version received 14 September 1983 Diazepam (70-150 µg/ml) significantly inhibits oxygen consumption by pig kidney embryo cells and causes the cellular ATP level to fall. ...

Еще в разделе: (Показать все результаты (>23) - cellmotility.genebee.msu.ru/ )

• http://cellmotility.genebee.msu.ru/html/articles/chern01.pdf
• http://cellmotility.genebee.msu.ru/html/articles/vorobjev83-1.pdf
• http://cellmotility.genebee.msu.ru/html/articles/vorobjev2002CBI.pdf

PHYSICAL REVIEW E, VOLUME 63, 046609 Enhancement of sum frequency generation near the photonic band gap edge under the quasiphase matching conditions A. V. Balakin, V. A. Bushuev, B. I. Mantsyzov,* I. A. Ozheredov, E. V. Petrov, and A. P. Shkurinov Department of Physics ... , France Received 8 September 2000; published 27 March 2001 We analyze theoretically and study experimentally the mechanisms of enhancement of the sum frequency and second harmonic ...

Еще в разделе: (Показать все результаты (>11) - genphys.phys.msu.su/ )

• http://genphys.phys.msu.su/rus/sci/photonics/PDF/JETP56.pdf

... 35, No. 2, pp. 87­99. i Star Formation History in the Central Region of the Barred Galaxy NGC 4245 O. K. Sil'chenko1* , I. V. Chilingarian1, 2 , and V. L. Afanasiev 1 2 3 Sternberg Astronomical Institute, Universitetskii pr. ... The galaxy has been found to possess a pronounced chemically decoupled compact stellar nucleus, which is at least a factor of 2.5 richer in metals than the stellar population of the bulge, and a ring of young stars with a radius of 300 pc. ... NGC 4245. ...

Еще в разделе: (Показать все результаты (>38) - sn.sai.msu.ru/ )

• http://sn.sai.msu.ru/~sil/preprints/apj_694_2_1550.pdf
• http://sn.sai.msu.ru/~sil/preprints/aj_leo2.pdf
• http://sn.sai.msu.ru/~sil/preprints/counter.pdf

Journal of Analytical Chemistry, Vol. ... ARTICLES A Catalytic Method for Determining Cadmium(II), Nickel(II), and Zinc(II) Inhibitor Metals M. K. Beklemishev, E. N. Kiryushchenkov, T. A. Stoyan, and I. F. Dolmanova Department of Chemistry, Moscow State University, Vorob'evy gory, Moscow, 119992 Russia Received July 9, 2004; in final form, September 30, 2004 Abstract--The inhibitory effect of Cd(II), Ni(II), and Zn(II) on the oxidation of 3,3',5,5'-tetramethylbenzidine with periodate was detected. ...

Еще в разделе: (Показать все результаты (>15) - analyt.chem.msu.ru/ )

• http://analyt.chem.msu.ru/kinetics/papers/Polym-n%20Article%20Vestnik%202007.pdf
• http://analyt.chem.msu.ru/kinetics/papers/Zhmaeva%20MeHg%20Alcoholdehydrogenase%20Mikr.%20Acta%202002.pdf
• Molecular mechanics study of the mixed-ligand lanthanide complexes using

Prehistoric Contacts between Hittite and Luvian: The Case of Reflexive Pronouns* Ilya Yakubovich University of Chicago The origin of the Hittite reflexive clitic = za represents an unsolved problem in Anatolian and Indo-European Studies. ... Hittite = za owes its existence to the paradigmatic generalization of the borrowed Luvian 2/3sg. reflexive clitic *=ti/*=di while the Luvian form must be derived from the Indo-Hittite dative clitic *= toi `to thee'. ... Hittite borrows Luvian *=ti/=*di. ...

Еще в разделе: (Показать все результаты (>18) - imk.msu.ru/ )

• http://www.imk.msu.ru/Publications/Vortrags/ivanov08_etruscans_MGU.doc
• http://www.imk.msu.ru/Structure/Linguistics/yakubovich/download/luwian.pdf
• http://www.imk.msu.ru/Structure/Linguistics/yakubovich/download/ENEMY.pdf

... Полная версия: Технические работы на сервере . Грация-МГУ::Форум > Общение > Другая жизнь . ... Apr 14 2011, 00:01 . ... сегодня весь день на сервере будут проводиться технические работы. ... Subject: Internet cleaning.....very important.. ... hours in order to allow us to clean it. ... Internet. ... Internet users has grown dramatically. ... to other sysops and Internet users as well. ... Internet users has grown dramatically. вопщем, очистка интырнетов это прекрастно во всех отношениях, ящитаю . ...

Еще в разделе: (Показать все результаты (>17) - grace.msu.ru/ )

• Технические работы на сервере - Грация-МГУ::Форум

... All Authors Title Abstract Index terms Full Text . ... Home > ICONO/LAT 2016 > 2014 International Conference on Laser Applications in Life Sciences > About the Conference > Submissions . ... All URL addresses in the text (e.g., http://pkp.sfu.ca ) are activated and ready to click. ... If submitting to a peer-reviewed track of the conference, authors' names are removed from submission, with "Author" and year used in the bibliography and footnotes, instead of authors' name, paper title, etc. ...

Еще в разделе: (Показать все результаты (>10) - hea.phys.msu.su/ )

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>3) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search