... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>11) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search

MGU Botanic Garden . SCHEDULE OF EXCURSIONS FOR INDIVIDUAL VISITORS . If you want to express your opinion about our excursions or suggest any proposals and make remarks, write us at otzyv_botsad@mail.ru . ... The excursion bureau of the MSU Botanical Gardens invites in May-October schoolchildren, students and anyone wishing to admire the open air collections and listen to the captivating stories about plants. ... Plant taxonomy (for schoolchildren and university students) . ...

Еще в разделе: (Показать все результаты (>21) - botsad.msu.ru/ )

• G.F.Hoffmann in Moscow
• Ботанический сад Московского университета

File patch tool for Foswiki . ... Patch files found on this system . ... Create a patch file . ... A real, non-pseudo-installed extension will crash configure if a perl version object is compared to an alpha string. 9999.99_999 will be used to indicate a pseudo-installed release. git-svn-id: http://svn. foswiki .org/trunk@15909 0b4bb1d4-4e5a-0410-9cc4-b2b747904278 ~~~ PATCH fdeeb7f236608b7792ad0845bf2279f9 lib / Foswiki / Configure /Dependency.pm ( Foswiki 1.1.5) --- lib / Foswiki / ...

Еще в разделе: (Показать все результаты (>3984) - wiki.cmc.msu.ru/ )

• PerlDoc < System < Foswiki
• (backlinks in all Webs) FamFamFamSilkIcons < System < Foswiki
• (backlinks in all Webs) FamFamFamMintIcons < System < Foswiki

File patch tool for Foswiki . ... Patch files found on this system . ... Create a patch file . ... A real, non-pseudo-installed extension will crash configure if a perl version object is compared to an alpha string. 9999.99_999 will be used to indicate a pseudo-installed release. git-svn-id: http://svn. foswiki .org/trunk@15909 0b4bb1d4-4e5a-0410-9cc4-b2b747904278 ~~~ PATCH fdeeb7f236608b7792ad0845bf2279f9 lib / Foswiki / Configure /Dependency.pm ( Foswiki 1.1.5) --- lib / Foswiki / ...

Еще в разделе: (Показать все результаты (>1683) - wiki.cs.msu.ru/ )

• PerlDoc < System < Foswiki
• (backlinks in System Web) FamFamFamMiniIcons < System < Foswiki
• (backlinks in all Webs) FamFamFamSilkIcons < System < Foswiki

... 1998 1 : Defended the Doctorate Degree Thesis on "Models of Cosmic Ray Particle Fluxes (Development and Applications)". ... Space Weather . ... Nymmik R.A., Radiation Environment Induced by Cosmic Ray Particle Fluxes in International Space Station Orbit According to Recent Solar and Galactic Cosmic Ray Models, Adv. ... Nymmik R.A., Radiation Environment Induced by Cosmic Ray Particle Fluxes in International Space Station Orbit According to Recent Solar and Galactic Cosmic Ray Models, Adv.Space Res. ...

Еще в разделе: (Показать все результаты (>8) - srd.sinp.msu.ru/ )

... Scientific Effort . ... Cosmic ray astrophysics . Space Physics . ... Nuclear physics . ... The paper was prepared with contributions from Elena Popova from the Skobeltsyn Institute of Nuclear Physics (Lomonosov Moscow State University) and was published in Scientific Reports. ... Federal State Budget Educational Institution of Higher Education M.V.Lomonosov Moscow State University, Skobeltsyn Institute of Nuclear Physics (SINP MSU), 1(2), Leninskie gory, GSP-1, Moscow 119991, Russian Federation . ...

Еще в разделе: (Показать все результаты (>4) - sinp.msu.ru/ )

... О КАФЕДРЕ ? ... ОБЩАЯ ИНФОРМАЦИЯ О КАФЕДРЕ ? ... СОТРУДНИКИ КАФЕДРЫ ? ... Школа ЮНЕСКО / UNESCO SCHOOL . ... заведующий кафедрой ЮНЕСКО по изучению глобальных проблем факультета глобальных процессов МГУ имени М.В.Ломоносова . ... В настоящее время является заведующим кафедрой ЮНЕСКО факультета глобальных процессов МГУ имени М.В.Ломоносова. ... 2005-2013 Факультет глобальных процессов МГУ имени М.В. Ломоносова / Исполнение и поддержка ресурса: Союз молодых ученых и специалистов Евразии ...

Еще в разделе: (Показать все результаты (>3) - unesco.fgp.msu.ru/ )

• ОБЩАЯ ИНФОРМАЦИЯ О КАФЕДРЕ ? GENERAL INFORMATION ABOUT THE CHAIR Кафедра ЮНЕСКО

I NSTITUTE OF PHYSICS PUBLISHING PHYSICAL B IOLOGY Phys. Biol. 3 (2006) 121­129 doi:10.1088/1478-3975/3/2/004 Direct simulation of plastocyanin and cytochrome f interactions in solution I B Kovalenko1,AMAbaturova1, P A Gromov2,DMUstinin1, E A Grachev2, G Yu Riznichenko1 and ABRubin1 1 2 ... 2006 Online at stacks.iop.org/PhysBio/3/121 Abstract Most biological functions, including photosynthetic activity, are mediated by protein interactions ... We use this structure in our simulation. ...

Еще в разделе: (Показать все результаты (>39) - library.biophys.msu.ru/ )

• http://library.biophys.msu.ru/matorin/3414.pdf
• http://library.biophys.msu.ru/matorin/3413.pdf
• http://library.biophys.msu.ru/matorin/3409.pdf

... N.5, pp.592-597 (scanned PDF file, English version) . ... A.V.Shanin, Embedding formula for electromagnetic diffraction problem // Zapiski seminarov POMI, V.324, pp.247-261 (2001), in Russian, (PDF file, Russian version) (PDF file, English version) . ... PDF file) . ... Shanin A.V., Coordinate equations for the Laplace-Beltrami problem on a sphere with a cut // QJMAM, 2005 (58) 2, 1-20 The preprint versions of two previous papers have been sent to URSI contest: Paper 1, PDF file , Paper 2, PDF file ...

Еще в разделе: (Показать все результаты (>42) - acoustics.phys.msu.ru/ )

... It was found that CNT-based filters are efficient for the adsorption of heavy metals from aqueous solution. DETERMINATION OF THE NI (Tl) DETECTOR EFFICIENCY USING RADIOACTIVE PARALLELEPIPED SOURCES Mohamed S. Badawi1), Mona M. Gouda1), Ahmed M. El-Khatib1), Mohamed A. Elzaher2), Abouzeid A. Thabet3), Ahmed A. Salim1) and Mahmoud I. Abbas1) 1) Physics Department , Faculty of Science, Alexandria University , 21511 Alexandria, Egypt , 2) Department of Basic and Applied Sciences, ...

Еще в разделе: (Показать все результаты (>83) - danp.sinp.msu.ru/ )

• http://danp.sinp.msu.ru/LIIWM/JPhys_ConfSer194_8_082007_VAKho.pdf
• http://danp.sinp.msu.ru/LINT/NIMB270_2012_P50.pdf
• http://danp.sinp.msu.ru/LAS/Nimb230_05_583ShulgaMashkova.pdf

Laboratory of Microfluidics and Nanofluidics . Laboratory of Physical Chemistry of Modified Surfaces . ... Research . ... Laboratory of Micro- and Nanofluidics . ... Professor B.V.Derjaguin moved to the Laboratory with his research group as an Emeritus Professor. ... In 1993 Professor Olga I. Vinogradova took over the leadership of the Laboratory. In 2009 the Laboratory of Micro- and Nanofluidics was organized by Professor Olga I. Vinogradova at the Physics Department of the M.V.Lomonosov MSU. ...

Еще в разделе: (Показать все результаты (>60) - nanofluidics.phys.msu.ru/ )

Школа танцев Грация-МГУ . ... Грация-МГУ::Форум Общение Творчество . IDEAS , с другого угла . ... 69er~ . ... Сообщение #1 . talking head . ... My interest is in the future because I am going to spend the rest of my life there. Charles F. Kettering . ... Feb 9 2009, 00:02 . ... Mar 16 2009, 17:46 . ... Dec 6 2009, 13:15 . ... Подписка на тему Сообщить другу Версия для печати Подписка на этот форум . ...

Еще в разделе: (Показать все результаты (>109) - grace.msu.ru/ )

• Ищу партнершу - Грация-МГУ::Форум
• Грация-МГУ::Форум > Гарри Поттер и принц-полукоровка
• Club_Cards - Грация-МГУ::Форум

.., . . , .. , , , projective scenarios method, image of the future, groups screen play of a social system ­ ­ . , , , , . On the basis of application of projective method ­ writing of a group fairy tale ­ the author considers the strategic of life future experts in the field of social science. Are consider vision of the social system from a position of a geographical location, the resources, of a political system available today, government, laws in force, political leaders and time of life.

Еще в разделе: (Показать все результаты (>74) - vestnik.socio.msu.ru/ )

• http://www.socio.msu.ru/vestnik/archive/2010/1/01.pdf
• http://www.socio.msu.ru/vestnik/archive/2010/3/14.pdf
• http://www.socio.msu.ru/vestnik/archive/2013/2/10.pdf

... Настоящим выпуском антропологи МГУ объявляют о появлении нового издания 'Вестник Московского университета. Серия ХХIII. Антропология'. ... В продолжение традиций мы надеемся, что 2009 год станет годом обновления Музея антропологии Московского университета, который откроется в Старом здании на Моховой после ремонта и реконструкции. ... Балахонова Е.И. Африканские коллекции из Московского Публичного и Румянцевского музея в Музее антропологии МГУ. ... А.Л. Пурунджан (1947-2009) Открыть . ...

Еще в разделе: (Показать все результаты (>27) - www.anthropos.msu.ru/ )

... Aptamer DNA : A New Type of Thrombin Inhibitors V. A. Spiridonova*,1 E. V. Rog**, T. N. Dugina***, S. M. Strukova***, and A. M. Kopylov** *Belozersky Institute of Physicochemical ... State University, Vorob'evy gory, Moscow, 119899 Russia Received November 13, 2002; in final form, November 21, 2002 Abstract--The formation of complexes between various thrombin preparations and 30-mer aptamer DNA was comparatively studied, and a correlation between the ... 5 2003 Vol. ... Vol. ...

Еще в разделе: (Показать все результаты (>6) - rnp-group.genebee.msu.ru/ )

• http://rnp-group.genebee.msu.ru/pages/pdf/nar2004.pdf
• http://rnp-group.genebee.msu.su/pdfs/article_vas_bioelectro.pdf
• http://rnp-group.genebee.msu.ru/pages/pdf/biochem2002_1.pdf

NMW survey overview . Access image archive . ... The New Milky Way survey aims to detect bright (V<13.5) optical transients near the Galactic plane using an automated wide-field (8x6 deg.) system capable of surveying the whole Milky Way area visible from the observing site in one night. ... All images obtained during the transient search survey are available online (please use the image archive access form ). ... Images per field: . ... Images per night: . ... Milky Way imaging time: . ...

Еще в разделе: (Показать все результаты (>3) - scan.sai.msu.ru/ )

First Russian Conference "OZONE AND OTHER ENVIRONMENT FRIENDLY OXIDANTS. ... 7-9 June 2005, Moscow . ... State of Art and Perspectives of Ozone Application for Water Treatment in Russian Federation . ... The foreign as well as the native ozonizers are used at these stations. ... State Univ. ... The report on the impulse corona ozonizer (Russian Scientific Centre 'Kurchatov Institute', 'NTC ECOS', Moscow) with ozone synthesized from the undrained air was presented to the participants of the Workshop. ...

Еще в разделе: (Показать все результаты (>25) - www.kge.msu.ru/ )

• Moscow State University resources
• Education
• Семинар "Озон и другие экологически чистые окислители" -

Proceedings of ICHIT- 06 26 February - 5 March 2006, Moscow, Russia DIRECT NUMERICAL SIMULATION OF TURBULENT RAYLEIGH-BENARD CONVECTION IGOR B. PALYMSKIY Modern Academy for Humanities, Novosibirsk Branch , Novosibirsk, Russia, 630064 palymsky@hnet.ru Abstract Turbulent convectional flow of water in horizontal layer with free and rigid horizontal boundaries, arising by heating from below, is numerically simulated by spectral method using the Boussinesq model without ... Present, 2-D, free, | ...

Еще в разделе: (Показать все результаты (>30) - hit-conf.imec.msu.ru/ )

• http://hit-conf.imec.msu.ru/2006/CD/Palymskiy1.pdf
• http://hit-conf.imec.msu.ru/2006/Template.doc
• Moscow 2006

... At present, SDSS (ugriz), UKIRT WFCAM (YJHK), ; Johnson-Cousins (UBVRcIc), and 2MASS (J2H2Ks2) ; are supported ; redshift - redfshift of a galaxy ( floating point) ; colour_name - colour identification (string) ; colour_value - value of colour in magnitudes ( floating point) ; should be in the AB mags for ugrizYJHK ; and in Vega mags for Johnson-Cousins/2MASS colours ; ; RETURN VALUE: K-correction in the specified filter for given redshift ; and ...

Еще в разделе: (Показать все результаты (>6) - kcor.sai.msu.ru/ )

• http://kcor.sai.msu.ru/calc_kcor.pro
• K-corrections calculator (version 2010): download IDL, Python and C code

Tatiana V. Salnikova . NAME: Tatiana V. Salnikova DATE OF BIRTH: June 28, 1960 CITIZENSHIP: Russian PROFESSIONAL AFFILIATION: Moscow State University, Department of Mathematics and Mechanics OFFICE ADDRESS: Tatiana V. Salnikova, Moscow State University Dept. of Maths. Mechanics, Theoretical Mechanics and Mechatronics Leninskie Gory Moscow 119992 Russia E-mail: tatsalni@mech.math.msu.su HOME ADDRESS: Tatiana V. Salnikova Litovski street 5/10, apt. ...

Еще в разделе: (Показать все результаты (>2) - www.theormech.math.msu.su/ )