НЕЛИНЕЙНЫЕ ВОЛНЫ В ДНК. АНАЛИТИЧЕСКИЕ ИССЛЕДОВАНИЯ И КОМПЬЮТЕРНОЕ МОДЕЛИРОВАНИЕ . ... Обсуждаются и сравниваются результаты аналитических исследований и компьютерного моделирования нелинейных конформационных волн в ДНК. ... Показано, что с помощью компьютерных методов удается получить новые нелинейные волновые решения, которые не удавалось получить аналитическими методами. ... These waves are the solutions of the equations describing large-amplitude rotational motions of DNA bases. ...

Еще в разделе: (Показать все результаты (>28) - www.library.biophys.msu.ru/ )

• ФИЗИЧЕСКИЕ ПОДХОДЫ В ИССЛЕДОВАНИЯХ ДНК

... Gpu | ... 10 , MULtI- GPU ABSoft Neat Video Adobe After Effects CC Autodesk Flame Premium Boris FX Continuum Complete Cinnafilm Dark Energy Plug-in CoreMelt complete eyeon Fusion GenArts Monsters Gt GenArts Sapphire roBUSKEY Neat Video open FX NewBlueFX Video Essentials NewBlue titler Pro Pixelan AnyFX re:Vision Effects red Giant Effects Suite red Giant Magic Bullet Looks the Foundry HIEro the Foundry NUKE and NUKEX Video Copilot Software Element 3D ... Q=Quadro Gpu, T=Tesla Gpu. ...

Еще в разделе: (Показать все результаты (>4) - ccoe.msu.ru/ )

... В первую очередь, это определяется потребностью в определении глутаминовой кислоты в клинической и фундаментальной медицине, в фармацевтической и пищевой промышленности, в биотехнологии. ... Ishikawa H., Misaki H., Muto N. L-Glutamate oxidase, its production and analytical method therefor. ... Zhang S., Yu J. Immobilization of L-glutamate oxidase and peroxidase for glutamate determination in flow injection analysis system. ... Enzyme electrode for specific determination of L-glutamate. ...

Еще в разделе: (Показать все результаты (>486) - www.nature.web.ru/ )

• Новое о галактике М33
• Эксперты Пентагона рекомендуют отложить развертывание
• Изучение белок-белковых взаимодействий. Метод двойного гибрида

. Лаборатория биофизики клетки: Объявления о семинарах и др. / . archives . Правка . Недавние изменения . Настройки . You need to use the ikiwiki-calendar program to generate calendar-based archive pages. Ссылки: sidebar . Редактировалось в последний раз Sun Oct 11 21:47:07 2015

Еще в разделе: (Показать все результаты (>6) - cell.biophys.msu.ru/ )

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>9) - mouse.genebee.msu.ru/ )

Uneex . SeminarFeature . ... Определение спама как нежелательной почты в противовес массовой рассылке . Классические методы защиты от спама и их недостатки . ... Методы, основанные на поведении спамера: Greylisting , TMDA и т. п. Основной источник спама, обходящего классические методы защиты . ... Общая схема построения (feature-based) классификаторов . ... Copyright 2003 by the contributing authors. ... Send feedback to svv at cmc dot msu dot ru. ...

Еще в разделе: (Показать все результаты (>5) - uneex.cs.msu.su/ )

... High Power Linear Accelerators . Fig 3a: One-section schematic . ... Our CW LINAC family consists of ten accelerators each with beam currents of 50 mA and energies ranging from 0.6 to 6 MeV in increments of 600 keV with corresponding beam power of 30 to 300 kW. ... Fig 4a: Two-section schematic . ... Our two-section CW LINAC seen in Fig. 4 consists of one-section CW LINAC, beam line between first and second AS, and second AS which accelerates the 50 mA beam up to the energy 1.2 MeV. ... 0.6 MeV . ...

Еще в разделе: (Показать все результаты (>3) - vserv.sinp.msu.ru/ )

• RTM-CS

... Форумы > Аспирантура > Тема . Автор темы ter . Форумы Список тем Новая тема . ... PhD positions in logic and AI, Vancouver (Canada) . PhD positions are available in the area of logic-based artificial intelligence. ... interested in logic (or discrete mathematics) and its uses for practical problem solving. ... Online application information is available at: . ... Следующая тема Предыдущая тема . ... Сайт работает с 29.08.2000, Copyright 2000 2011 MMOnline.Ru and MMForce.Net, . ...

Еще в разделе: (Показать все результаты (>127) - www.mmonline.ru/ )

• MMOnline | Форумы | Аспирантура | PhD position in the University of Florida

. Научная Библиотека . Отдел Обслуживания Физического Факультета МГУ . Water and Environment Journal . Weed Biology and Management . Weed Research . Winterthur Portfolio . WorkingUSA . World Banking Abstracts . World Englishes . World Oil Trade . Worldviews on Evidence-Based Nursing . Wound Repair and Regeneration . (495) 939-16-96, 939-42-04 . Copyright ї 2004 mailto:lib@phys.msu.su . Научная Библиотека Физического факультета МГУ имени М. В. Ломоносова . Разработано EA Studio .

Еще в разделе: (Показать все результаты (>11) - wwwlib.phys.msu.ru/ )

... ICONO Invited Speakers . ... Gennadiy Kulipanov, Budker Inst. of Nuclear Physics, Russia . ... Marlan Scully, Texas A&M Univ., ... Andrey Goncharov, Inst. of Laser Physics, Russia . ... Vladimir Trunov, Inst. of Laser Physics, Russia . ... Since 1987, he has worked at the National Research Council of Canada (Ottawa) in the field of laser physics and trapped ion optical frequency standards. ... Alexey Taichenachev , Inst. of Laser Physics, Russia . ... S. Vatnik, Inst. of Laser Physics, Russia . ...

Еще в разделе: (Показать все результаты (>6) - iconolat13.phys.msu.ru/ )

• Symposia
• Program topics

2011, 61, 4, . ... The Method of Correlation Analysis of EEG Synchronism and its Possibilities A. P. Kulaichev Department of Higher Nervous Activity, Moscow State University e mail: akula @mail.ru A new method for estimation of EEG synchronism based on the analysis of correlation between ampli tude modulation processes (envelopes) is considered. ... 42% 0.6 0.99 , 0.42, 98.5% 0.6 0.17 ( 1404 1715 ) . ... 2. rxy ( ­ rxy > 0.2; ­ rxy > 0.6; ­ rxy > 0.8); ­ : ­ ; ­ , . ... rjk j,k . ...

Еще в разделе: (Показать все результаты (>18) - www.protein.bio.msu.ru/ )

• http://www.protein.bio.msu.ru/~akula/Kulaichev%20Addition.pdf

The files containing information about Affymetrix microarrays were downloaded from the official Affymetrix site. ... Probe sequences were mapped to the genome using Blat. ... The hits found "probe alignment regions" were . ... We annotated each probe alignment region using the mRNA and EST alignments provided by UCSC, considering only . ... The textual part of the interface consists of probe information section, probe alignment section and transcription state . ... Each gene and each probe alignment . ...

Еще в разделе: (Показать все результаты (>4575) - mouse.belozersky.msu.ru/ )

... Nonlinear optics of ionized mediums . Fiber lasers . ... Emergence of powerful laser systems, being able to deliver powerful ultrashort light pulses, allows one to investigate and exploit new class of nonlinear-optical phenomena, based on the media ionization, when the electrons are released by strong electromagnetic field directly or by collision of an atom with another electron accelerated in the field. ... Ultrafast optical switching of an ionized medium by interfering ultrashort laser pulses. ...

Еще в разделе: (Показать все результаты (>46) - photonicslab.phys.msu.ru/ )

• Neurophotonics
• Publications

COACHES . ... Kiseljev Dmitri . Head Coach . ... Lukyanchikov Dmitri . First Base coach, Power Lifting coach . ... Komissarov Dmitri . 3rd Base coach, Power Lifting coach . ... Erjemkin Alexey . ... Chichaev Ivan . ... Rich Reddrop* . ... Frolikov Alexey . ... Kudrjashov Alexander . ... Chichaev jr . ... Ned Reddrop* . ...

Еще в разделе: (Показать все результаты (>3) - mguteam.chat.ru/ )

• http://mguteam.chat.ru/komiss1.html

... Роджер Пэнг (љ Roger Peng) на своем youtube-канале выложил видео 4х недель своего курса ?Computing for Data Analysis? Week 1 : . ... Data Types . ... Reading/Writing Data: Part 1 . ... The ?str? function . ... Writing Functions . ... The mapply function in R . ... Using the apply function in R . ... Plotting (base graphics) . ... Plotting with lattice . ... IBM SPSS Statistics 20 и AMOS: профессиональный статистический анализ данных Самые важные научные исследования последнего десятилетия. ...

Еще в разделе: (Показать все результаты (>16) - tukachev.flogiston.ru/ )

ARM . 12: · ARM 2 ARM Powered Products 3 ARM · 4 · ARM 32- . ARM : ­ Byte - 8 bits ­ Halfword - 16 bits ( ) ­ Word - 32 bits ( ) · ARM ­ 32-bit ARM Instruction Set ­ 16-bit Thumb Instruction Set 5 · ARM : ­ User : , ­ FIQ : , high priority (fast) ­ IRQ : , low priority (normal) ­ Supervisor : Software Interrupt instruction ­ Abort : ­ Undef : ­ System : , 6 User ARM Current Visible Registers Abo Und rtMod SVCMode IRQ ef Mode FIQ Mode e User ...

Еще в разделе: (Показать все результаты (>9) - lvk.cs.msu.su/ )

• http://lvk.cs.msu.su/~sveta/SDN_OpenFlow_controllers_lecture2.pdf

FACULTAD DE CIENCIAS POLITICAS DE LA UNIVERSIDAD ESTATAL DE MOSCз M. V. LOMONсSOV Encargado del cargo de Decano - El doctor de ciencias historicas, Profesor (A. Yu. ... Al dia de hoy en la Facultad de Ciencias Politicas, funcionan cinco catedras: . ... La Facultad de Ciencias Politicas presta la posibilidad de realizar estudios especializados en los siguientes programas de estudio por contracto, los cuales han sido diseЯados con base a las necesidades del mercado laboral. ...

Еще в разделе: (Показать все результаты (>17) - polit.msu.ru/ )

• http://polit.msu.ru/pub/fl-doc/French.doc
• Профессор Елена Борисовна Шестопал приняла участие в конференции Кембриджского

ft ra D DAYS on DIFFRACTION 2012 1 Theory of selfrefraction effect of intensive fo cused acoustical b eams V.A. Gusev Lomonosov's Moscow State University, Physical Faculty, Department of Acoustics, Russia, 119991, Moscow, Leninskie gori; e-mail: vgusev@bk.ru The theory of selfrefraction of nonlinear acoustical beams is developed based on some exact and approximate analytical equations and solutions. ... What is the main factor limiting the pressure in the focus -- diffraction or selfrefraction? ...

Еще в разделе: (Показать все результаты (>43) - acoustics.phys.msu.ru/ )

• http://acoustics.phys.msu.su/teachers/gordienko_files/localization_eng.pdf
• A.V.Shanin

О лаборатории . ... Лаборатория теоретической биофизики . ... Here the guide to use RESP technique based on calculations from Firefly or GAMESS-US is presented. ... Note, that RESP algorythm will fit potential in the set of points which are selected according to $PDC group in the input-file. ... Нет комментариев " Using RESP with GAMESS-US and Firefly (PC-GAMESS) " . ... Using Firefly/GAMESS-US efficiently . ... Scannin? in Using Firefly/GAMESS-US efficiently? 2012 ERG Research Group . ...

Еще в разделе: (Показать все результаты (>29) - erg.biophys.msu.ru/ )

The Database of Close Binary Systems . ... Team . ... This web-based interactive database is being developed and maintained by a team at the Sternberg Astronomical Institute of the Moscow State University . The project is an on-line extension of our catalogue on "Highly Evolved Close Binary Stars" (volumes I, II) published by Gordon and Breach in 1996. As of September 2009, the database (both the software and the content) is in its development/testing phase. ...

Еще в разделе: (Показать все результаты (>2) - dionis.sai.msu.ru/ )