... The Department of Operations Research . April 9, 2016 . Welcome Traditional topics of the conference Important dates Abstracts Registration . Final program Accommodation Program committee Organizing committee . ... V Moscow International Conference . on Operations Research, . ... Moscow, April 10-14, 2007 Important dates . ... Abstract deadline: December 20, 2006 . New deadline: January 10, 2007 . Notification of submission: February 1, 2007 . Create Date : 23.05.05 . ...

Еще в разделе: (Показать все результаты (>12) - io.cs.msu.ru/ )

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>12) - mouse.genebee.msu.ru/ )

• StructAlign feedback

MPI. ... C: #include <mpi.h> 14 MPI MPI- C (case sensitive): error = MPI_Xxxxx(parameter,.. ... Send : , , ­ Receive: , , 27 MPI () MPI - , (blocking) (non-blocking) ­ Blocking: ­ Non-blocking: , 28 MPI (modes) (Mode) Synchronous send Buffered send Standard send Ready send Receive (Completion Condition) ( ), ( ) ( ), 29 MPI «-» () (MODE) Standard send Synchronous send Buffered send Ready send Receive MPI MPI _ Send MPI _ Ssend MPI _ Bsend MPI _ Rsend ...

Еще в разделе: (Показать все результаты (>5) - angel.cmc.msu.ru/ )

• http://angel.cmc.msu.ru/~basrav/supercomp2010/Regatta_metodichka.doc

... Individual SELEX products, aptamers, are small molecules (40­100 nt) that have a unique three-dimensional structure, which provides for their specific and high-affinity binding to targets varying from low-molecular-weight ligands to proteins. ... Selection of aptamers binding with a target is the key step in SELEX, as aptamers account for only a small fraction of the initial library (one aptamer per 109 to 1013 molecules) [6]. ... Fourth, modification can increase the aptamer affinity for a target. ...

Еще в разделе: (Показать все результаты (>7) - rnp-group.genebee.msu.ru/ )

• http://rnp-group.genebee.msu.su/pdfs/article_vas_bioelectro.pdf
• http://rnp-group.genebee.msu.su/pdfs/febsz.pdf
• http://rnp-group.genebee.msu.ru/pages/pdf/biochem2003.pdf

International Symposium Biological Motility: New facts and hypotheses ================================================= Pushchino , Moscow region, Russia May 12-14, 2014 Chairman of Organizing Committee Prof. Zoya Podlubnaya Institute of Theoretical and Phone (4967)739269 Experimental Biophysics RAS Fax (4967)330553 Pushchino , Moscow region E-mail: motility2014@iteb.ru 142290, Russia Preliminary information Dear colleagues, The ... Deadline for sending abstracts is 1 of March 2014. ...

Еще в разделе: (Показать все результаты (>3) - cytol.bio.msu.ru/ )

... The linguistic aspects of the model and the properties of the semantic dictionary ensuring the content analysis with compression of the text structure are considered. Our dictionary resources serve an instru- ment for building a multilevel textual semantic structure. ... Reason (A,B), where SemF(A) = SIT or a whole semantic formula; the same for SemF(B). ... Sem(SIT)R . ... Semantic Resources for Textual Content Compression // Fourth International Conference on Meaning-Text Theory (MTT'09). ...

Еще в разделе: (Показать все результаты (>4) - leontyeva.srcc.msu.ru/ )

• Semantic Dictionary for Text Understanding and Summarization
• Lexical Resources for Personal Data Recognition in Texts

... Each day a different image or photograph of our fascinating universe is featured, along with a brief explanation written by a professional astronomer. December 22, 1996 . 18 Miles From Deimos . Credit: The Viking Project , NASA . ... Potato shaped and barely 6 miles wide this asteroid-like body was visited by the Viking 2 orbiter in 1977. This image was made when the spacecraft approached to within 18 miles of Deimos' surface. ... About APOD > . ... NASA Technical Rep.: ...

Еще в разделе: (Показать все результаты (>33) - www.arcetri.astro.it/ )

• APOD: December 17, 1996 - Mariner's Mercury
• APOD: December 13, 1997 - The Coma Cluster of Galaxies
• APOD: December 6, 1999 - M83: The Southern Pinwheel Galaxy from VLT

... Multi-threaded search engines . ... Unfortunately, most documents on search engines I saw in the Internet were either lists of hyperlinks without any comments, or discussions about how many documents are in the database of ... (here is the name of a search engine) and what method of counting of the number of documents was used. No words about the efficiency, i.e. how many documents on some subject I can find using this search engine, especially in comparison with the other ones. ...

Еще в разделе: (Показать все результаты (>3) - scon155.phys.msu.ru/ )

S .. ... a database of structures of DNA-protein and RNA-protein complexes. ... a program for finding hydrophobic clusters in 3D structures of macromolecules . ... search of conserved hydrophobic clusters in aligned 3D structures of protein families . ... a program for analysis of multiple alignments . ... a program for automatic detection of aligned blocks in a multiple protein alignment. ... a program for detection of aligned blocks in a multiple alignment of sequences of PDB chains. ...

Еще в разделе: (Показать все результаты (>40) - monkey.belozersky.msu.ru/ )

• Inquiry information || Rule of four sequences

... VaST is a software tool for finding variable objects on a series of astronomical images. ... VaST performs object detection and aperture photometry using SExtractor on each image, cross-matches lists of detected stars, performs magnitude calibration with respect to the first (reference) image and constructs a lightcurve for each object. ... VaST FITS image viewer ./pgfv . ... Part I" PZP, vol. ... K. V. Sokolovsky, S. A. Korotkiy; "New Variable Stars Discovered by the NMW Survey" PZP, vol. ...

211. Динамические модели в биологии