... Seminar archive . ... The structure of the X-ray sources in the hard spectral state of accreting black-hole binaries has been a subject of intense debate. The paradigm dominant for many years postulated that the accretion disc in the hard state is truncated at some radius >> the innermost stable orbit (ISCO) whereas the disc reaches the ISCO in the soft state. ... On the other hand, there have been numerous claims in recent years that the disc extends to the ISCO in the hard state. ...

Еще в разделе: (Показать все результаты (>324) - master.sai.msu.ru/ )

• Общемосковский семинар астрофизиков имени Якова Борисовича Зельдовича
• Успехи Российской Астрофизики 2015 - Контакты

BS - 2D data processing program. BS is a windows version of the 2D X-ray data processing program BSL in use at the Daresbury Synchrotron radiation source, for the treatment of low angle diffraction data. ... It requires less memory, has separate window to see 1D graphics and allows export of the image in two common formats: BMP and TIFF. ... information about the data file .adc . add a constant to selected range in n frames from file .add . weighted addition of two images .arg . ...

Еще в разделе: (Показать все результаты (>3) - muscle.imec.msu.ru/ )

... If you have already registered, please fill in you login and password in the form below main menu (leftmost column). ... If something goes wrong (for example, you've been registered by site andministrator and don't have password at all or you just forgot it), please contact site administration by E-mail dubna2007@biophys.msu.ru . ... If you are warned that you've already registered please contact site administration by E-mail dubna2007@biophys.msu.ru to get access to your Personal Office . ...

Еще в разделе: (Показать все результаты (>113) - www.msm.biophys.msu.ru/ )

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>12) - mouse.genebee.msu.ru/ )

... When embedded within a base document, a URL in its absolute form may contain a great deal of information which is already known from the context of that base document's retrieval, including the scheme, network location, and parts of the url-path. ... Introduction This document describes the syntax and semantics for "relative" Uniform Resource Locators (relative URLs): a compact representation of the location of a resource relative to an absolute base URL. ... 3.1) Base URL embedded in the | ...

Еще в разделе: (Показать все результаты (>4) - hea-www.harvard.edu/ )

• http://mirror.msu.net/pub/rfc-editor/rfc-ed-all/rfc2396.txt

Главная Международные связи Иностранным студентам/ Incoming students . ... Semester Dates for International Students: . ... In case of institutional agreement on international student exchange the program is free of charge. ... All students should come to Russia by Moscow State University invitation. ... Students enter Russia with a single-entry visa. ... Exams/Passes . ... Pass . ...

Еще в разделе: (Показать все результаты (>205) - www.mgubs.ru/ )

• Летняя школа в Праге
• Высшая школа бизнеса МГУ им. Ломоносова

... Basic statement: "Mathematics is much clever, than Mathematician" It means, that after the scientist or engineer developed new mathematical model and designed corresponding equations, the solution to these equations produces new information unpredictable for the author! ... This vibration excites the shear wave in tissue 2 sx 2 - (ct + ) s x = Fx 2 t t Studies in Fluid Dynamics of water jet are connected with two main problems: 1. Flows in contracting nozzle forming high-speed jet. ...

Еще в разделе: (Показать все результаты (>46) - acoustics.phys.msu.ru/ )

• A.V.Shanin

... Laboratory of Medicinal Chemistry was established at the Department of Chemistry, Lomonosov Moscow State University in October 2013. ... We apply modern molecular modeling and chemoinformatics methods as well as develop new approaches. ... We have developed efficient methods for the analysis of quantitative structure-activity relationships and design of novel promising structures based on diverse theoretical approaches. ... Home . ... Research . ... 2016 Laboratory of Medicinal Chemistry ...

Еще в разделе: (Показать все результаты (>23) - qsar.chem.msu.ru/ )

• Palyulin, Vladimir A. - Laboratory of Medicinal Chemistry
• Orlov, Alexey A. - Laboratory of Medicinal Chemistry
• Voronkov, Andrew E. - Laboratory of Medicinal Chemistry

Клуб выпускников МГУ (Московский Государственный Университет) . ...

Еще в разделе: (Показать все результаты (>945) - www.moscowuniversityclub.ru/ )

• Клуб выпускников МГУ: ИНТАС объявляет ряд стипендиальных конкурсов для молодых
• Клуб выпускников МГУ: Senior International Fellows Program
• Клуб выпускников МГУ: Конкурс инновационных грантов

Information letter Dear colleagues! Faculty of Basic Medicine, Lomonosov Moscow State University and State Research Center ­ Institute for Biomedical Problems, Russian Academy of Science would like to invite you to participate in the work of the VII Russian National School with International Participation on Muscle and Exercise Physiology «New approaches to studying of classical problems». ... Abstracts of reports will be published. ... The receipt of your abstract will be confirmed by e-mail. ...

Еще в разделе: (Показать все результаты (>9) - www.fbm.msu.ru/ )

данных о себе // режимы работы // старт - приглашения для регистрации, редактирования // регистрация // редактирование (personal_id= password = все в строке запроса) // загрузка файла loadfoto (она же смена файла) // require _once($ GLOBALS [ DOCUMENT_ROOT ]. / mikromag /script/config.php3 ); require _once($ GLOBALS [ DOCUMENT_ROOT ]. / ...

Еще в разделе: (Показать все результаты (>99) - genphys.phys.msu.su/ )

• http://genphys.phys.msu.su/mikromag/script/phorum.php3
• Микромаг - сервер

Dmitry Karpov . Dmitry Karpov was born in Moscow, Russia. ... Dmitry Karpov studied mechanisms of formation of the valence band in the water Raman Scattering (RS) spectrum. In particular, he focused on (1) the effect of the ion hydration type change due to the temperature variation on the valence band shape in the water RSS and (2) the study of the Fermi resonance role in the formation of the valence band in the water RSS by using the RS temperature dependence. ...

Еще в разделе: (Показать все результаты (>49) - rswater.phys.msu.ru/ )

• Laboratory of laser spectroscopy of solutions of supramolecular compounds and
• Sergey Burikov

... He was graduated from Moscow State University, Faculty of Mechanics and Mathematics, and post-graduate course in a speciality Theory of Probabilities and Mathematical Statistics. ... Ph.D in mathematics in 1980 (Moscow State University, Faculty of Computer Science). ... Author of Popular Textbooks on Data Analysis and Statistics. ... He was graduated from Moscow State University in 1980. Ph.D in mathematics in 1988 (Moscow State University, Faculty of Mechanics and Mathematics). ... InCo . ...

Еще в разделе: (Показать все результаты (>5) - statsoft.msu.ru/ )

About SPAW Editor . ... As of final version 1.0 of the control you'll need to rename the file spaw_control.default.config.php in config sub-directory to spaw_control.config.php when installing control for the first time. ... All of the SPAW Editor configuration options are located in the config/spaw_control.config.php file. ... This file will be included in img_library.php (Image library dialog script). $request_uri variable will be set to the URL of the page where SPAW Editor instance resides. ...

Еще в разделе: (Показать все результаты (>6) - textbook.sinp.msu.ru/ )

Institute of Mechanics , . Lomonosov Moscow State University , . ... Phone: +7 495 939 2039 . Fax: +7 495 939 0165 . E-mail: mailybaev imec.msu.ru . ... Mathematics . stability theory and dynamical systems . ... Physics and Mechanical Engineering . ... Engineering Faculty, University of l'Aquila, Italy . ... Department of Engineering Mechanics, Dalian University of Technology, China . ... Institute of Engineering Mechanics and Systems, University of Tsukuba, Japan . ...

Еще в разделе: (Показать все результаты (>34) - mailybaev.imec.msu.ru/ )

• Curriculum Vitae of Dr Alexei A
• Multiparameter Stability Theory with Mechanical Applications
• Book review by Professor Teodor M. Atanackovic

... Faculty of Physics . ... Research Centers . ... Search Faculties Staff . Education . ... Any division Budget Depatment Center of Computer Physics (CCP) Center of Education Quality Control Center of Hydrophysical Studies Center of Information Systems and Technologies (CIST) Chair of Acoustics Chair of Astrophysics and Stellar Astronomy Chair of Atomic Physics , Plasma Physics , and Microelectronics Chair of Biophysics Chair of Celestial Mechanics, Astrometry, and Gravimetry ...

Еще в разделе: (Показать все результаты (>2) - phys.msu.su/ )

... MSU Chamber Orchestra . Concerts of . ... 1999/2000 season: . MOSCOW . ... German Music of XVII c. Johann ROSENMULLER (1620 - 1684) . ... Leontyevsky pereulok, 6 (metro station "Arbatskaya" or "Pushkinskaya") . ... MSU Chamber orchestra . ... Ulitsa Fadeeva, 4 (metro station "Mayakovskaya") . ... Big Hall of Moscow State University (the building at Vorobievy Gory) . ... MSU CHAMBER ORCHESTRA . ... The tickets are in the Moscow State Philarmony office . ... Big Hall of Moscow State University . ...

Еще в разделе: (Показать все результаты (>6) - music.genebee.msu.su/ )

• MSU Chamber Orchestra. Concerts. Season 2001/2002.
• MSU Chamber Orchestra. Concerts. Season 2000/2001.

. Frames are requied

Еще в разделе: (Показать все результаты (>2) - www.radio-msu.net/ )

MOSCOW STATE UNIVERSITY The Scientific Society of students of the Law Faculty January 25, 2014 1- The flyer of the Unit `Jurisprudence' of International scientific conference "Lomonosov - 2014" 1. ... The organizers of the Unit are the law faculty of Moscow State University and the Scientific Society of students of the law faculty. ... Administrative law 2. ... The Organizing Committee: Presiding Officer ­ Kozlova Natalya Vladimirovna (Deputy Dean of Law Faculty on study, Doctor in Law, Professor). ...

220. http://cryst.geol.msu.ru/staff/CV22.pdf