Symbolic circuit-matrix processor and evaluator . ... This software is reliable over the range of benchmark circuit complexity (both *.CIR and *.MAT file). ... SYMBOL is a symbolic-algebra package which in contrast to REDUCE, MACSYMA, MAPLE, MATHEMATICA, MathLAB, MathCAD and other known multi-purpose systems is especially intended for analysis of any lumped, linear, time-invariant circuit. ... pure ASCII text . ... CIRSYM - SYMbolic CIRcuit processor used to format ASCII text file *.out for CALCSYM. ...

Еще в разделе: (Показать все результаты (>19) - astrometric.sai.msu.ru/ )

• Scientific Literature
• Telephone

... Online Services | ... Chart of Nuclear Quadrupole Deformations. ... Electronic Chart of Deformation gives to one possibility to obtain in comfortable form (analogous to that of well-known Charts of the Nuclides) numerical information for various nuclear deformation parameters (quadrupole moment Q and quadrupole deformation parameter b 2 ) for ground states of many nuclei and contains the data from three sources: . ... 2 + ) data; . ... Chart of Nuclear Quadrupole Deformations structure. ...

Еще в разделе: (Показать все результаты (>57) - cdfe.sinp.msu.ru/ )

• CDFE provides the major photonuclear databases. Online Services.
• EXFOR Search Engine
• CDFE => Useful links

WERE HITTITE KINGS DIVINELY ANOINTED? ... This is the only clear evidence that the gods were thought to be personally responsible for the anointment of Hittite kings. ... I am arguing that anointment with oil was extended to both Hittite priestly kings and certain other categories of Hittite priests, and that the underlying purpose of this act was ritual cleansing. ... Its beginning is preserved in two mutually complementing parallel versions KUB 35.165 Obv. ... the priest, son of the king'. ...

Еще в разделе: (Показать все результаты (>13) - imk.msu.ru/ )

• http://www.imk.msu.ru/Structure/Linguistics/yakubovich/download/lydian.pdf
• http://www.imk.msu.ru/Structure/Linguistics/yakubovich/download/Hieroglyphs.pdf
• http://www.imk.msu.ru/Structure/Linguistics/yakubovich/download/luwian.pdf

... Reports on progress and error are always recorded in the log file of the program. ... UT date of the measurement finish in YYYY-MM-DD format UT time of the measurement finish in hh:mm:ss format Average flux in A aperture Average flux in B aperture Average flux in C aperture Average flux in D aperture Normalized variance of flux in A aperture Normalized variance of flux in B aperture Normalized variance of flux in C aperture Normalized variance of flux in D ...

Еще в разделе: (Показать все результаты (>28) - curl.sai.msu.ru/ )

• http://curl.sai.msu.ru/mass/download/doc/dimm_soft_description.pdf
• http://curl.sai.msu.ru/mass/download/doc/new_details_v2.pdf
• http://curl.sai.msu.ru/mass/download/doc/new_details.pdf

... Международные: . ... NICA-MPD . МЕЖДУНАРОДНЫЕ ПРОЕКТЫ. ... российский коллайдер протонов и тяжелых ионов, строящийся с 2013 года на базе Лаборатории физики высоких энергий (ЛФВЭ) им. В. И. Векслера и А. М. Балдина Объединенного института ядерных исследований (ОИЯИ), в городе Дубна Московской области. ... Ускорительный комплекс создается с целью исследования области физики частиц в ранее недоступной области параметров и условий эксперимента ? ...

Еще в разделе: (Показать все результаты (>2) - silab.sinp.msu.ru/ )

НЕЛИНЕЙНЫЕ ВОЛНЫ В ДНК. АНАЛИТИЧЕСКИЕ ИССЛЕДОВАНИЯ И КОМПЬЮТЕРНОЕ МОДЕЛИРОВАНИЕ . ... Обсуждаются и сравниваются результаты аналитических исследований и компьютерного моделирования нелинейных конформационных волн в ДНК. ... Показано, что с помощью компьютерных методов удается получить новые нелинейные волновые решения, которые не удавалось получить аналитическими методами. ... These waves are the solutions of the equations describing large-amplitude rotational motions of DNA bases. ...

Еще в разделе: (Показать все результаты (>23) - www.library.biophys.msu.ru/ )

• ВЛИЯНИЕ СВЯЗАННОЙ ВОДЫ НА СТУКТУРООБРАЗОВАНИЕ КОРОТКИХ ДВОЙНЫХ СПИРАЛЕЙ
• ФИЗИЧЕСКИЕ ПОДХОДЫ В ИССЛЕДОВАНИЯХ ДНК

... Resources . ... Eurasian Center . for Food Security . Home About About Eurasian Center for Food Security . ... Our mission: ?аPromote and coordinate collective actions for strengthening food security in Eurasia through research and development. ... The ECFS Mission should be creating conditions for the development and implementation of a coherent agricultural policy that ensures soil fertility, conservation of natural resources and ensuring food security of the Eurasian region. ...

Еще в разделе: (Показать все результаты (>15) - ecfs.msu.ru/ )

• Draft Plan of Action for Eurasian Subregional Partnership | ECFS
• Online Consultation on Network and Partnerships in the area of Food Security |

... Consequently, weak fluctuations of the 1 growth rate concerning the M growth rate must necessarily generate strong fluctuations of the 2 growth rate. ... Statistics show that financial shocks occurred at positive values of ()(GDP). ... To test our hypothesis we consider correlation between TSec ґ an average annual growth rate of the market yield on U.S. Treasury securities at 1-year constant maturity ґ and ()-(GDP) over 1960-2009. ... Correlation between ()-(GDP) and the yields spread became...

Еще в разделе: (Показать все результаты (>21) - www.mse-msu.ru/ )

• http://www.mse-msu.ru/RAS_Resolution.pdf
• http://www.mse-msu.ru/files/k1205.pdf

... The teaching aids were founded as a result of the collaboration between the historical information science laboratory, and the source studies department, Lomonosov Moscow State University, and the department of economic history and information technology of the history faculty, Ogareva Mordovskii State University. ... The teaching aids are not specifically oriented towards students and historians, but also to all interested in the application of statistical methods in historical research. ...

Еще в разделе: (Показать все результаты (>9) - www.hist.msu.ru/ )

• Editions
• The Laboratory of Historical Information Sciences

... Seminar archive . ... Seminar archive 1998 9 October . ... ФТИ ) . ... На основе измерения спектров квазаров с высоким разрешением мы получили прямые следующие ограничения на среднюю скорость изменения постоянной тонкой структуры alpha : . alpha'/alpha| < 3.1 10 -14 yr -1 . ... Endeavours of the unification of the four fundamental interactions have resulted in a development of theories having cosmological solutions in which low-energy limits of fundamental physical constants vary with time. ...

Еще в разделе: (Показать все результаты (>23) - master.sai.msu.ru/ )

... The students of the Faculty of Geography study territorial distribution and spatial development patterns of various natural phenomena as well as social and economic objects. ... The academic program includes courses with lectures, seminars, laboratory and field training in natural sciences and humanities which form 4 blocks: . ... In addition to the field stations of the Faculty, the students have an opportunity to have their field training in scientific institutions and different companies. ...

Еще в разделе: (Показать все результаты (>4) - www.eng.geogr.msu.ru/ )

• Selenga-Baikal research

Submission Instructions Please read all instructions before completing the form. ... Name: | ... Name Phone | ... No Yes |( ... Are written and dated laboratory records and data available? ... Please provide date of defence or anticipated date of defence. ... Was the invention created using confidential information of a third party? ... result in similar information no longer being supplied to the University when | ... Inventor's signature(s) (if selecting option A, | ... Print Name Signature | ...

Еще в разделе: (Показать все результаты (>22) - innovation.msu.ru/ )

• Start-Up Company Development :: Управление инновационной политики и организации

. Лаборатория биофизики клетки: Объявления о семинарах и др. / . archives . Правка . Недавние изменения . Настройки . You need to use the ikiwiki-calendar program to generate calendar-based archive pages. Ссылки: sidebar . Редактировалось в последний раз Sun Oct 11 21:47:07 2015

Еще в разделе: (Показать все результаты (>5) - cell.biophys.msu.ru/ )

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>7) - mouse.genebee.msu.ru/ )

Uneex . SeminarFeature . ... Определение спама как нежелательной почты в противовес массовой рассылке . Классические методы защиты от спама и их недостатки . ... Методы, основанные на поведении спамера: Greylisting , TMDA и т. п. Основной источник спама, обходящего классические методы защиты . ... Общая схема построения (feature-based) классификаторов . ... Copyright 2003 by the contributing authors. ... Send feedback to svv at cmc dot msu dot ru. ...

Еще в разделе: (Показать все результаты (>13) - uneex.cs.msu.su/ )

The Database of Close Binary Systems . ... Team . ... This web-based interactive database is being developed and maintained by a team at the Sternberg Astronomical Institute of the Moscow State University . The project is an on-line extension of our catalogue on "Highly Evolved Close Binary Stars" (volumes I, II) published by Gordon and Breach in 1996. As of November 2009, the database (both the software and the content) is in its development/testing phase. Sternberg Astronomical Institute ...

Еще в разделе: (Показать все результаты (>13) - uranus.sai.msu.ru/ )

• Linux on CLEVO 8750

. Научная Библиотека . Отдел Обслуживания Физического Факультета МГУ . Water and Environment Journal . Weed Biology and Management . Weed Research . Winterthur Portfolio . WorkingUSA . World Banking Abstracts . World Englishes . World Oil Trade . Worldviews on Evidence-Based Nursing . Wound Repair and Regeneration . (495) 939-16-96, 939-42-04 . Copyright © 2004 mailto:lib@phys.msu.su . Научная Библиотека Физического факультета МГУ имени М. В. Ломоносова . Разработано EA Studio .

Еще в разделе: (Показать все результаты (>5) - wwwlib.phys.msu.ru/ )

... Academic Programmes . ... Russian Language Programmes . ... A balanced program of speaking, listening, writing and reading skills ensure that all students make progress as quickly as possible. ... Listening/Speaking : you will be able to understand basic instructions or take part in a basic factual conversation on a predictable topic. ... Reading : you will be able to read quickly enough to cope with an academic course, to read the media for information or to understand non-standard correspondence. ...

Еще в разделе: (Показать все результаты (>21) - www.cie.ru/ )

• Certification :: Les programmes d?enseignement :: CEI
• Admissions :: CIE
• Elective Courses :: Academic Programmes :: CIE

... В первую очередь, это определяется потребностью в определении глутаминовой кислоты в клинической и фундаментальной медицине, в фармацевтической и пищевой промышленности, в биотехнологии. ... Ishikawa H., Misaki H., Muto N. L-Glutamate oxidase, its production and analytical method therefor. ... Zhang S., Yu J. Immobilization of L-glutamate oxidase and peroxidase for glutamate determination in flow injection analysis system. ... Enzyme electrode for specific determination of L-glutamate. ...

Еще в разделе: (Показать все результаты (>255) - www.nature.web.ru/ )

• Эксперты Пентагона рекомендуют отложить развертывание
• Изучение белок-белковых взаимодействий. Метод двойного гибрида
• Научная Сеть - Scientific Network

... 001.89:004 .. , .. , .. , .. , .. , .., .. e-mail: kryukov@theory.sinp.msu.ru RESTFUL-- 2012-4/882 RESTful-- , : , , , UNIDATA Common Data Model, , , , , , . ... NCEP/NCAR [1], , ). , . ... RESTful-- , : , , , UNIDATA Common Data Model [2], , , , , , . ... UNIDATA Common Data Model (CDM) [2]. ... UNIDATA CDM 3. ... XML . ... Unidata Common Data Model. : http://www.unidata.ucar.edu/software/netcdf-java/CDM/ [3]. ... Network Common Data Form (NetCDF). : http://www.unidata.ucar.edu/software/netcdf/ [5]...

Еще в разделе: (Показать все результаты (>3) - sinp.msu.ru/ )

• SINP MSU