... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>6) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search
• About

Subdeletion structures as additional evidence for different analysis of synthetic and analytic comparatives in Russian In Russian there are two seemingly interchangeable comparative forms of adjectives: synthetic (the suffix -ee) and analytic (the word bolee). ... One more peculiar characteristic pertaining to synthetic rather than analytic comparatives in Russian is the inability of the former to appear in so-called subdeletion structures. ... Masa vyse Vani. i(analytic+GEN). ... Pancheva, Roumyana. ...

Еще в разделе: (Показать все результаты (>306) - www.philol.msu.ru/ )

• http://www.philol.msu.ru/~otipl/new/main/people/kibrik-aa/cv.html
• Совет молодых ученых филологического факультета МГУ им. М.В. Ломоносова
• Московское типологическое общество :: МГУ :: Филфак :: ОТиПЛ

... Fast Facts about the Faculty of Journalism . ... Academic Departments . ... Partners . ... All partners . ... The Faculty of Journalism, Lomonosov Moscow State University has a long legacy of academic excellence, and we continue to build on that legacy in ways that prepare students to succeed as media professionals in a rapidly changing world. ... Thank you for your interest in the Faculty of Journalism. ... 1999-2014 Faculty of Journalism, Lomonosov Moscow State University . ...

Еще в разделе: (Показать все результаты (>61) - www.journ.msu.ru/ )

• About MSU :: Department of Journalism, M. V. Lomonosov Moscow State University
• :: Department of Journalism, M. V. Lomonosov Moscow State University <span

... Two-dimension linear regression model. ... The econometric modeling of time series . ... The course aims to provide students with basic models and methods of econometric modeling of financial time series. ... The course considers in detail the major methods of econometric modeling of time series, in particular modeling by stochastic processes, modeling of stationary and non-stationary time series, the spectrum analysis of time series. ... The problem of tax optimization under a given state budget. ...

Еще в разделе: (Показать все результаты (>11) - io.cmc.msu.ru/ )

HOMEPAGES OF MUSCLE PEOPLE or GROUPS AROUND THE WORLD . ... King's College, London . Michael Ferenczi . Imperial College of Science, Technology & Medicine, London . ... Michael Reedy . ... London Muscle Series . ... European Biophysical Societies' Association . European Society for Muscle Research . ... Argonne National Laboratory, USA  . ... Daresbury Laboratory, UK . MUSCLE-RELATED PERIODICALS . Biophysical Journal . ... The Journal of Physiology . ...

Еще в разделе: (Показать все результаты (>3) - muscle.imec.msu.ru/ )

• BS Form

... sought for such use through Elsevier's permissions site at: http://www.elsevier.com/locate/permissionusematerial ARTICLE IN PRESS JOURNAL OF SOUND AND VIBRATION Journal of Sound and Vibration 298 (2006) 471 - 474 www.elsevier.com/locate/jsvi Short Communication Wolfhard Kliema, Alexei A. Mailybaevb,Г, Christian Pommer a copy Conditions revisited for asymptotic stability of pervasive damped linear ... In the case of an indefinite damping matrix, system (1) may be stable or unstable. ...

Еще в разделе: (Показать все результаты (>31) - mailybaev.imec.msu.ru/ )

• Dr Alexei A. Mailybaev

... A comparative study of thermodynamic for both natural and artificial RNA/DNA ­ protein complexes would establish bases for a specificity of complex formation. In particular, we have shown that aptamers could be used for a direct measuring of thrombin enzymatic activity in a solution. D 2002 Published by Elsevier Science B.V. Keywords: RNA/DNA ­ protein interactions; Ribosome; SELEX; RNA/DNA aptamers; Thrombin; Enzymatic activity 1. ... The aptamer binds to the protein with Kd = 0.5 nM. ...

Еще в разделе: (Показать все результаты (>6) - rnp-group.genebee.msu.ru/ )

• http://rnp-group.genebee.msu.ru/pages/pdf/nar2004.pdf
• http://rnp-group.genebee.msu.ru/pages/pdf/biochem2002_1.pdf
• http://rnp-group.genebee.msu.ru/pages/pdf/biochem2003.pdf

... An extended set of observables of the nuclear quasi-free (p, d + ) reaction including the triple differential cross-section for coincidence measurements, its analyzing power in case of polarized proton beams and, also, the parameters of the polarization of the excited recoil nucleus and the produced deuteron are considered in the framework of the distorted-wave impulse approximation using the reaction 16 O(p, d + )15 N at a proton energy of 650 MeV as an example. ...

Еще в разделе: (Показать все результаты (>3) - np-chair.sinp.msu.ru/ )

... for Food Security . Home Events Online Consultation on Network and Partnerships.. ... This discussion will serve as a preparatory stage for the upcoming International Conference on International Conference on Eurasian Food Security and Nutrition Network and Eurasian Soil Partnership to be held in Bishkek, February 29-March 2, 2016. ... Topic 1: Building the Eurasian Food Security Network . ... International Forum on Eurasian Food Security and Nutrition Network and Eurasian Soil Partnership read . ...

Еще в разделе: (Показать все результаты (>16) - ecfs.msu.ru/ )

• Draft Plan of Action for Eurasian Subregional Partnership | ECFS
• The Department of land resources | ECFS
• About Eurasian Center for Food Security | ECFS

... The students of the Faculty of Geography study territorial distribution and spatial development patterns of various natural phenomena as well as social and economic objects. ... The academic program includes courses with lectures, seminars, laboratory and field training in natural sciences and humanities which form 4 blocks: . ... In addition to the field stations of the Faculty, the students have an opportunity to have their field training in scientific institutions and different companies. ...

Еще в разделе: (Показать все результаты (>5) - www.eng.geogr.msu.ru/ )

... 28 марта 2016 года Палата патентных поверенных совместно с МГУ имени М.В. Ломоносова и ?Иннопрактикой? провели круглый стол на тему ?Включение изобретения в проектную документацию как факт его использования?. ... Компания ?Иннопрактика?, объединяющая Центр национального интеллектуального резерва МГУ и Фонд ?Национальное интеллектуальное развитие?, 18 декабря подведет итоги конкурсного отбора прорывных идей ?Эврика! ... 2012 Центр национального интеллектуального резерва МГУ имени М.В. Ломоносова . ...

212. Водород в MoS2-нанотрубках

213. Alexey Garber

214. Лаборатория Вычислительных Методов в Химии

---

Астронет | Научная сеть | ГАИШ МГУ | Поиск по МГУ | О проекте | Авторам

Комментарии, вопросы? Пишите: info@astronet.ru или сюда