Cosmic Research, Vol. 42, No. 5, 2004, pp. 489­534. Translated from Kosmicheskie Issledovaniya, Vol. 42, No. 5, 2004, pp. 509­554. Original Russian Text Copyright © 2004 by Panasyuk, Kuznetsov, Lazutin, Avdyushi, Alexeev, Ammosov, Antonova, Baishev, Belenkaya, Beletsky, Belov, Benghin, Bobrovnikov, Bondarenko, Boyarchuk, Veselovsky, Vyushkova, Gavrilieva, Gaidash, Ginzburg, Denisov, Dmitriev, Zherebtsov, Zeleny, Ivanov-Kholodny, Kalegaev, Kanonidi, Kleimenova, Kozyreva, Kolomiitsev, Krasheninnikov,

Еще в разделе: (Показать все результаты (>2) - solarwind.cosmos.ru/ )

• http://www.kosmofizika.ru/buri/vesel2.pdf

... Заключительные этапы эволюции магм Ключевского вулкана (Камчатка) по данным изучения расплавных включений в минералах высокоглиноземистых базальтов: данные по изучению магматических включений в минералах+Ключевского вулкана . ... Н.Л.Миронов " Эволюция высокоглиноземистых базальтов Ключевского вулкана (Камчатка) по данным изучения магматических включений в минералах " . ... Вулкан. ... Первичные расплавы известково-щелочных магнезиальных базальтов Ключевского вулкана (Камчатка) // Геохимия, 1998 . ...

Еще в разделе: (Показать все результаты (>238) - www.nature.web.ru/ )

• Заключительные этапы эволюции магм Ключевского вулкана (Камчатка) по данным
• M81 и M82 в поле зрения GALEX
• Протеолитический процессинг у синдбис-подобных вирусов

Geometric Structures in Integrable Systems Sergey Adzhiev (with Victor Vedenyapin), Entropy for generalised quantum kinetic and Liouville equations. Abstract: In his 1872 paper L. Boltzmann proved H-theorem for a class of kinetic equations. ... Abstract: P. Clarkson and M. Kruskal (1989) proposed a method for finding reductions of partial differential equations with two independent variables. ... Gennady El, Kinetic equation for a soliton gas ­ a new integrable system? ...

Еще в разделе: (Показать все результаты (>82) - new.math.msu.su/ )

• http://new.math.msu.su/department/hydro/papers/Osiptsov-Asmolov-PoF-2008.pdf
• http://new.math.msu.su/department/probab/spec/Materialy_po_kursam_Tutubalina/Finstat/Bashelie/Bachelier100years.pdf
• Andrei Vladimirovich Fursikov | Department: General Problems of Control.

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>16) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• ConClus

MSU . ... Every year since 2004, the MSU Science Park has conducted an educational program and an innovation project competition called Success Formula (www.successformula.ru). ... In collaboration with the Center of Technology Transfer at Moscow State University and the Chair of Innovation Economics, MSU Science park offers a wide range of educational programs like Success Formula as well as infrastructure projects geared to the incubation of new technology companies on the Moscow University site. ...

Еще в разделе: (Показать все результаты (>9) - www.sciencepark.ru/ )

... Applications of Molecular Mechanics to Metal Complexes" . ... Molecular mechanics study of the mixed-ligand lanthanide complexes using Gillespie-Kepert model . ... Within MM-GK, the same parameters are applicable to complexes of different coordination numbers/polyhedra. ... Gillespie-Kepert model . ... Using derived computational parameters, we calculated the geometry of 39 lanthanide ion nonaaqua complexes, 6 octaaqua complexes and 18 beta- diketonate and aqua-beta-diketonate complexes. ...

Еще в разделе: (Показать все результаты (>33) - analyt.chem.msu.ru/ )

. Jump to: navigation , search . You must log in to view other pages. Retrieved from " http://algcourse.cs.msu.su/teachwiki/index.php/Special:Contributions/93.180.27.85 " . Special page . Log in . Новости, главное . Страница курса . Сдача заданий . 1-й семестр 2015 г. Материалы по системе ejudge . Планы прошлых лет . Участники . Recent changes . Special pages . Privacy policy . About MediaWiki . Disclaimers

Еще в разделе: (Показать все результаты (>5) - algcourse.cs.msu.su/ )

Contemporary media environment is formed by dense concentration and interaction of cultures, languages, channels and modalities of communication. ... Across this new terrain, rich, exciting and risky, the new generation of media practitioners, teachers, researchers and public intellectuals is expected to navigate competently and creatively. ... Nor can the idea of intercultural communication be limited (as it was тАУ only recently) to relatively formal contact between established national cultures. ...

Еще в разделе: (Показать все результаты (>4) - discours.philol.msu.ru/ )

... concentration with respect to the anion A, calculated from the position of the elements in the Periodic Table; (b) AA(n/m') or C'C (this depends on the VECA value) which correspond to the average number of electrons 0108-7681/90/010007-17503.00 per tetrahedron available for bonds between anions or between central atoms (and/or for electron lone pairs on the central atom), respectively; and finally (c) C'AC ' which expresses the average ... No base tetrahedron with this code is possible. ...

Еще в разделе: (Показать все результаты (>29) - cryst.geol.msu.ru/ )

COMPARISON OF CLUSTERING ALGORITHMS FOR SPEAKER IDENTIFICATION Nikolay Lubimov, Evgeny Mikheev, Alexey Lukin Moscow Lomonosov State University, Moscow, Russia In this paper we consider the problem of text-independent speaker identification that refers to acoustic recognition research. ... We have performed the comparison of different clustering methods for speaker identification: the standard K-means clustering, K-means++, Linde-Buzo-Gray, Fuzzy C-means, and Gustafson-Kessel algorithms. ...

Еще в разделе: (Показать все результаты (>148) - imaging.cmc.msu.ru/ )

• http://imaging.cs.msu.ru/pub/2011.Graphicon.Zipa_Ignatenko.MetallicCoating.en.pdf
• http://imaging.cs.msu.ru/pub/2011.Graphicon.Samsonov_Ignatenko.CameraCalibration.en.pdf
• http://imaging.cs.msu.ru/pub/2011.Graphicon.Nasonov_Krylov.Metrics.en.pdf

... Начало www.99ru.ru Страны и континенты Балканы 1159 . ... Введите код товара из каталога. автор PRIJATELJ, KRUNO . Хорватия Dalmatian Painting of the 14th to the 20th centuries . ... Summary: In the project "Selected questions of Dalmatian painting of the 14th to the 20th centuries" research was carried out on numerous not studied or not enough examined questions of the history of painting in Dalmatia in the cited course of time. The paintings from the 14th century were the oldest studied. ...

Еще в разделе: (Показать все результаты (>20) - www.bukivedi.ru/ )

• www.99ru.ru - 1984 6242

Nurtdinov RN, Neverov AD, Mironov AA and Gelfand MS. (2006) Conserved and species-specific alternative splicing in mammalian genomes. submitted . Ermakova EO, Nurtdinov RN and Gelfand MS. (2006) Fast rate of evolution in alternatively spliced coding regions of mammalian genes. BMC Genomics. ... BMC Bioinformatics. ... 2004) J Mol Evol. ... Nurtdinov RN, Artamonova II, Mironov AA and Gelfand MS. (2003) Low conservation of alternative splicing patterns in the human and mouse genomes. ...

197. http://www.socio.msu.ru/vestnik/eng/archive/2015/1/02.pdf

198. http://temporology.bio.msu.ru/EREPORTS/krugly_amplitudes.pdf

199. http://dfgm.math.msu.su/files/papers-sym/0503389v1.pdf

200. http://www.eng.math.msu.su/download/dictionary.pdf