... Department . ... Department of the Automation for Scientific Research (ASR) was founded in 1988 on the basis of research and teaching group of the Mathematical Physics Department (former Department of Computational Mathematics). ... Under his guidance the department performs wide spectrum of research in the field of computer simulation of complex systems and processes. ... https://cs.msu.ru/node/1707 . ... 2008?2016 ASR Department , CMC Faculty , Lomonosov MSU . ...
MOSCOW STATE UNIVERSITY The Scientific Society of students of the Law Faculty January 25, 2014 1- The flyer of the Unit `Jurisprudence' of International scientific conference "Lomonosov - 2014" 1. ... The organizers of the Unit are the law faculty of Moscow State University and the Scientific Society of students of the law faculty. ... Administrative law 2. ... The Organizing Committee: Presiding Officer Kozlova Natalya Vladimirovna (Deputy Dean of Law Faculty on study, Doctor in Law, Professor). ...
[
Текст
]
Ссылки http://law.msu.ru/bitcache/bc6ca81fd934d7083472270ea392667daf49eebb?vid=30191&disposition=attachment&op=download -- 260.2 Кб -- 28.02.2014 Похожие документы
LUT Summer School: www.lut.fi/summerschool summerschool@lut.fi Guide for Student Advisers Greetings from your colleagues at Lappeenranta University of Technology! ... With the wide-ranging selection of courses on-offer during the LUT Summer School we aim to both challenge and inspire students. ... Lappeenranta and LUT Lappeenranta is located some 220 km northeast of Finland's capital, and about 230 km northwest of St. Petersburg, Russia. ... The fee will be given on the LUT Summer School web pages. ...
[
Текст
]
Ссылки http://www.phys.msu.ru/rus/about/structure/admin/OTDEL-FOREIGN/INVITATIONS/LUT_Summer_School_2013_staff.pdf -- 448.5 Кб -- 17.01.2013 Похожие документы
MOSCOW STATE UNIVERSITY The Scientific Society of students of the Law Faculty January 15, 2013 1 - The flyer of the Unit `Jurisprudence' of International scientific conference "Lomonosov - 2013" 1. ... Administrative law 2. ... Members of the Council of Experts: Golichenkov Alexander Konstantinovich (Head of the Law Faculty, head of the chair of land and ecological law, Doctor in Law, Professor) Romanov Stanislav Vladimirovich (Deputy Dean on instructional work, Candidate in Law, Docent). ...
[
Текст
]
Ссылки http://www.law.msu.ru/bitcache/da2ecb4c4c1ad0c8d4c795e346afcf80b93bd045?vid=25267&disposition=attachment&op=download -- 302.6 Кб -- 25.02.2013 Похожие документы
Вы посетили: autobio_engl.html . ... 1998: Student at the Moscow State University, Department of Mathematics and Mechanics . ... Degree, Moscow State University . ... 2001: Ph.D. student at the Moscow State University, Department of Mathematics and Mechanics, Faculty of Algebra . ... 2007: Assistant professor at the Moscow State University, Department of Mathematics and Mechanics, Faculty of Algebra . ... staff/guterman/autobio_engl.html.txt Последние изменения: 13.02.2013 11:26 (внешнее изменение) | ...
About particularities of intensities distribution in cross-section of powerful laser beams . ... The time of the beam aperture scanning was about 10 -2 - 10 -3 s. On occasion to measure the intensity distribution in the beam cross-section the small spherical mirrors with the diameter of about 5 - 10 mm were placed instead of mirror fringes. ... Such technique allowed by character of a luminescence corundum to investigate transformations of spatial distribution of intensity in a laser beam. ...
... VaST is a software tool for finding variable objects on a series of astronomical images. ... VaST performs object detection and aperture photometry using SExtractor on each image, cross-matches lists of detected stars, performs magnitude calibration with respect to the first (reference) image and constructs a lightcurve for each object. ... VaST FITS image viewer ./pgfv . ... Part I" PZP, vol. ... K. V. Sokolovsky, S. A. Korotkiy; "New Variable Stars Discovered by the NMW Survey" PZP, vol. ...
... The problem of behavior of lower layer of the Earth crust in the process of continental subduction was studied basing on conception of two-staged plate tectonic. ... The dynamic of the change of the crust thickness in the orogens in 20 m.y. time in obtained, which corresponds to the real collision time. ... FRACTAL ANALYSIS AND SEARCHING FOR DETERMINISM IN EEG DATA. ... Our analysis show that time series of seismic energy have fractal properties in a range more than one order on frequency. ...
2011, 61, 4, . ... The Method of Correlation Analysis of EEG Synchronism and its Possibilities A. P. Kulaichev Department of Higher Nervous Activity, Moscow State University e mail: akula @mail.ru A new method for estimation of EEG synchronism based on the analysis of correlation between ampli tude modulation processes (envelopes) is considered. ... 42% 0.6 0.99 , 0.42, 98.5% 0.6 0.17 ( 1404 1715 ) . ... 2. rxy ( rxy > 0.2; rxy > 0.6; rxy > 0.8); : ; , . ... rjk j,k . ...
[
Текст
]
Ссылки http://www.protein.bio.msu.ru/~akula/JourVND1104007KulaichevLO.pdf -- 517.7 Кб -- 08.06.2011 Похожие документы
... B Dispatch: 30.1.04 Author Received: Journal: JEB CE: Kumar No. of pages: 12 PE: Sri doi:10.1111/j.1420-9101.2004.00705.x Human birthweight evolution across contrasting environments F. T H OMAS , * A . ... The model illustrates that optimal birthweight depends on which fitness-reducing risk locally predominates (somatic diseases, parasitic diseases or adverse environmental conditions). ... Growth in utero, blood pressure in childhood and adult life, and mortality from cardiovascular disease. ...
[
Текст
]
Ссылки http://ecology.genebee.msu.ru/3_SOTR/CV_Terekhin_publ/2004_Birthweight_JEvolBio.pdf -- 284.1 Кб -- 16.03.2009 Похожие документы
The dynamics of binary alternatives for a discrete pregeometry arXiv:1201.0005v1 [gr-qc] 28 Dec 2011 Alexey L. Krugly Abstract A particular case of a causal set is considered that is a directed dyadic acyclic graph. ... Each vertex possesses two incident incoming edges and two incident outgoing edges. ... There are two types of external edges: incoming external edges and outgoing external edges. ... The number n of incoming or outgoing external edges is not changed by this elementary extension. ...
[
Текст
]
Ссылки http://temporology.bio.msu.ru/EREPORTS/krugly_the-dinamics.pdf -- 257.4 Кб -- 27.02.2014 Похожие документы
... astro-ph/0303500 . ... В Архиве электронных препринтов появилась интересная и важная обзорная работа с юбилейным номером 0303500. Космический телескоп им. Хаббла . ... Благодаря столь широкому охвату читатель может узнать о множестве открытий последнего десятилетия в астрономии. Существенно и то, что Ливио не просто перечисляет открытия, он много рассказывает о физике явлений. ... Список ссылок занимает 15 страниц. ... Галактики на больших красных смещениях глазами Космического телескопа . ...
... Your girlfriend is ... than George's. much more beautifuler . ... Much of London ... by fire in the seventeenth century. destroyed . ... John prefers .... travelling by air to travelling on train . ... English, this year he .. ... Yesterday I bought a ... shirt. white new cotton . ... The professor said that .... the students can turn over their reports on Monday . the reports on Monday could be received from the students by him . the students could hand in their reports on Monday . ...
Как реагирует растительное сообщество модели горного луга на увеличение фонового озона, его пиковых концентраций и их совместное воздействие . ... Изучалось воздействие повышенных концентраций озона на моделируемые нагорные сообщества, содержащие семь разновидностей злаков. ... Принимая во внимание, что резкое повышение концентраций озона пагубно влияет на растительность, это исследование показывает, что для моделируемых сообществ поля увеличение концентрации озона сопровождается ускоренным старением. ...
... The simplest stabilization control has the form s 2 = \Gamma1 T — x Indeed, in this case the Lyapunov function v 1 = 1 2 \Gamma — x T — x + x T\Omega x \Delta is infinitely large and its derivative has the form dv 1 dt = \Gamma љ x ffi \Gamma 1 T — x \Delta 2 by virtue of system (2). ... System (11) is locally stabilizable if the controls u 1 = љ 1 g sign \Gamma (x 1 \Gamma x 2 )( — x 1 \Gamma — x 2 ) \Delta u 2 = \Gammaљ 2 g sign ( — x 2 + — x 3 + \Delta \Delta \Delta + — xn ) are used. ...
[
Текст
]
Ссылки http://num-anal.srcc.msu.su/list_wrk/ps1/ch4st4.ps -- 78.5 Кб -- 17.12.2002
[
Текст
]
Ссылки http://num-anal.srcc.msu.ru/list_wrk/ps1/ch4st4.ps -- 78.5 Кб -- 17.12.2002 Похожие документы
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
... Siberian Lang . Minority languages of Siberia as our cultural heritage . ... The project ?Development of the web-site ?Minority languages of Siberia as our cultural heritage? (on the material of the languages of the basin Middle Yenisei and the Middle and the Upper Taz)? was realized at the Laboratory for Computational Lexicography, Research Computing Centre, Lomonosov Moscow State University, with financial support from Russian Foundation for the Humanities, grant 12-04-12049.љ ...
... in contrast to smth -showing a difference between people, ideas, situations, things etc that are being compared to a lesser extent-used to say how true smth is or how great or small an effect or change is globally-affecting or including the whole world overall-considering or including everything on the whole anyway-admitting that what was said before doesn't matter, this is the main point but-used to connect two statements or phrases when the second one adds ...
[
Текст
]
Ссылки http://www.eng.math.msu.su/download/Model_rendering_scheme_and_connectives.pdf -- 82.8 Кб -- 02.10.2011 Похожие документы
Theoretical problems of electrical double layer structure on ideally polarized electrodes and reversible adsorption of ions and neutral organic molecules on electrodes are considered, and also the specific features of kinetics of multistage electrochemical processes limited by mass transfer, electron transfer and chemical reaction. ... Acta, 1997, V.42, P.737. ... 1997, V.33, N 10. ... 1997, V.33, N 11. head@elch.chem.msu.ru . ...
... Cell Biol, 1997, Vol. 11 (2), pp. ... In the cells polarized at the edge of an experimental wound, cytoplasmic granules moved randomly (Brownian motions) and by separate jumps (saltatory movements). ... In such cells, we observed radial tracks (going from the nucleus to the edge of the lamella) and tangential tracks (when the movement of the granule was tangential to the nucleus). ... In the spread part of the leading edge of a cell, as a rale, not more than two granules (3-4%) proved out of focus. ...
[
Текст
]
Ссылки http://cellmotility.genebee.msu.ru/html/articles/grigoriev97.pdf -- 1506.7 Кб -- 17.05.2002 Похожие документы