... 8-915-053-98-34, e-mail: stitova3@gmail.com URL: http://mobithinking.com 2 , 199 . ... URL: http://www.smart-edu.com/index.php/statie-learning/e-learning-v-rossii-%E2%80%93-itogi-2010-i-zadachi-na-2011.html Attewell J. Mobile Technologies and Learning: a technology update and m-learning project summary. ... URL: http://www.aupress.ca/index.php/books/120155 Savill-Smith C., Attewell J., Stead G. Mobile Learning in Practice: Piloting a mobile learning teachers' toolkit in further education colleges. ...

Еще в разделе: (Показать все результаты (>79) - ffl.msu.ru/ )

• About Us

Available on CMS information server CMS NOTE 2000/065 The Compact Muon Solenoid Experiment Mailing address: CMS CERN, CH­1211 GENEVA 23, Switzerland CMS Note ``SingleTop'' ­ an event generator for the single top quark production at the LHC. ... But this process has sufficiently different signature which is similar to the top quark pair production signature. ... The events for the two main processes of the single top quark production at the LHC are available in the CMS processes data base PEVLIB [14]. ...

Еще в разделе: (Показать все результаты (>9) - top.sinp.msu.ru/ )

• http://top.sinp.msu.ru/lev/d0note_3612.ps

The Department of Talented Youth Affairs and Professional Orientation . ... Projects . ... Before the start of the lecture the introduction was delivered by Rector of Lomonosov Moscow State University V.A. Sadovnichy, who initiated the educational project ?Literary Evening? that was held with a great success throughout the year. ... 2016 - The Department of Talented Youth Affairs and Professional Orientation ...

Еще в разделе: (Показать все результаты (>58) - talant.msu.ru/ )

• CERN School | The Department of Talented Youth Affairs and Professional
• Junior Space School in MSU SINP | The Department of Talented Youth Affairs and
• admin | The Department of Talented Youth Affairs and Professional Orientation

... GIREDMET, Moscow . ITAE RAS, Moscow . ... Institute of information, Moscow . ... Ответственный исполнитель с российской стороны - профессор А.В.Ведяев. ... Лаборатория Spintec, Лаборатория Луи Нееля национального центра научных исследований (г. Гренобль Франция) Ответственный исполнитель с российской стороны - профессор А.В.Ведяев. ... Ответственный исполнитель с российской стороны - профессор А.Б.Грановский. ... Ответственный исполнитель с российской стороны - доцент Н.С.Перов. ...

Еще в разделе: (Показать все результаты (>29) - magn.phys.msu.ru/ )

... The department was founded in late sixties by Prof. D.Ya.Martynov, who for many years was also the director of Sternberg Astronomical Institute. At present time, the head of the department is Prof. A.M.Cherepashchuk, a pupil of D.Ya.Martynov and his successor as the director of SAI. Since Prof. Martynov, the scientific activity of the department was primarily related to binary stars. ... The department consists of 15 members most of which have Ph.D. in Astrophysics. ...

Еще в разделе: (Показать все результаты (>17) - uranus.sai.msu.ru/ )

• Ilya Livshits Home Page

... Based on the concept of -matrix and Choi­Jamiolkowski states we develop the approach of quantum process reconstruction. ... The approach is tested with the statistical reconstruction of the polarization transformations in anisotropic and dispersive media realized by means of quartz plates and taking into account the spectral structure of input polarization states. ... Knowing the input and measured (output) states, one can reconstruct the -matrix of the quantum process. ... Mixed state...

Еще в разделе: (Показать все результаты (>95) - qi.phys.msu.ru/ )

• http://qi.phys.msu.ru/papers/2010-prl-105-010404.pdf
• http://qi.phys.msu.su/papers/2005-jetpl(e)-82-164.pdf
• PUBLIC

... Moscow State University, Sternberg Astronomical Institute . ... Moscow State University, Sternberg Astronomical Institute, Cremian Laboratory . Dr. Vladimir Amirhanyan - Soft, Radioobservations, Interpretations . Sternberg Astronomical Institute . Aleksandr Belinskiy - mechanics, soft, observations, interpretation . ... Mikhaylo Kuznecov - mechanics, soft, observations, interpretation . ... Moscow State University, Physics Department . ... Gleb Antipov - observations, interpretation . ...

Еще в разделе: (Показать все результаты (>24) - observ.pereplet.ru/ )

• MASTER GLOBAL ROBOTIC TELESCOPES NET

KEYWORDS: language evolution, mathematical modelling, branching processes . ... 2 Basic assumptions. ... Dying out, giving birth, and preserving of sign's meanings. ... Modelling of language evolution should be based on some assumptions concerning its micro-level, i.e. level of its micro-units' development. ... That is why it has become the starting point in the building of the mathematical model for the development in time and synchronic correlation of the whole system of a sign's features. ...

Еще в разделе: (Показать все результаты (>65) - old.philol.msu.ru/ )

• Melnikov G.P.- Systemology and Linguistic Aspects of Cybernetics
• MSU-LGCLL:: Anatoliy A.Polikarpov - Semasiological and Word-formational
• MSU-LGCLL:: Anatoliy A. Polikarpov - Some Factors and Regularities of

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>16) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/fasta.out

Cell Biology International 27 (2003) 293­294 Cell Biology International www.elsevier.com/locate/jnlabr/ycbir Short communication Microtubule dynamics in living cells : direct analysis in the internal cytoplasm Ivan A. Vorobjev a a,* , Irina B. Alieva a, Ilya S. Grigoriev b, Gary G. Borisy c Laboratory of Cell Motility, A.N. Belozersky Institute, Moscow State University, Moscow, Russia b Department of ... These data demonstrate that MT growth is impeded at the cell margin. ...

Еще в разделе: (Показать все результаты (>40) - cellmotility.genebee.msu.ru/ )

• http://cellmotility.genebee.msu.ru/html/articles/amchencova98.pdf
• http://cellmotility.genebee.msu.ru/html/articles/Alieva04.pdf
• http://cellmotility.genebee.msu.ru/html/articles/uzbekov96.pdf

... 2013/04/16 - 11:59am . Opening of the educational programme - School of CEOs, "Capsule of security" for the key managers of Bashneft Group. 2013/04/02 - 4:30pm . ... Site map . Site search . MSU website . ... This site (RSS) . E -mail: info@hsmi.msu.ru . Phone: +7 495 932-80-73 . Fax: +7 495 932-80-73 . 2006-2016 MSU Higher School of Management and Innovation. ...

Еще в разделе: (Показать все результаты (>10) - hsmi.msu.ru/ )

... About CIE MSU . ... Student's Life . ... About Moscow University . ... Lomonosov Moscow State University . ... About Lomonosov Moscow State University . Lomonosov Moscow State University is the oldest and largest classic university in Russia. ... Every year over 40 thousand students study at the MSU, over 5 thousand are foreign students from 80 countries. ... Foreign students undergo training at the Center for International Education before entering the main faculties of the MSU. ... Students? ...

Еще в разделе: (Показать все результаты (>23) - www.cie.ru/ )

• L?Universit? d?Etat de Moscou (MGU) :: CEI
• Russian Teachers Training Programmes :: Academic Programmes :: CIE
• Admissions :: CIE

... Head of the seminar: Prof. B.V. Somov, . ... The seminar considers the questions related to generation of magnetic fields in astrophysical plasmas, effect of the magnetic reconnection and particle acceleration in strong magnetic fields, the origin and propagation of cosmic rays, the flares and other non-stationary phenomena in the solar atmosphere and solar wind, Sun Earth connections and physical processes in the heliosphere. ... On the Topological Models and Topological Trigger of the Solar Flares...

Еще в разделе: (Показать все результаты (>3) - sun.sai.msu.ru/ )

• Solar Physics Department

... WRF (Weather Research and Forecasting Model) [9]. ... NOAH LSM (National Centers for Environmental Prediction, Oregon State University, Air Force, Hydrology Lab-NWS Land Surface Model) [3]. ... WRF ­ (Urban Canopy Model, UCM) [6] (Building Environment Parameterization, BEP) [8]. ... C ­ ( HA = r · HR + rw·Ha ). , r ­ ( UCM NOAH LSM « » , , , (, .) H = A H ­ , LSM +A HA , (, H ­ ; A , , ); A ­ , (, , ); HLSM ­ , NOAH LSM; HA ­ , UCM. ... 48 1 29 2007 00 . ... WRF) : - NOAH; UCM - ; BEP - . ...

Еще в разделе: (Показать все результаты (>4) - atm563.phys.msu.ru/ )

... Русский English . Background . ... The Faculty of Bioengineering and Bioinformatics, Lomonosov Moscow State University was founded in 2002 with the express purpose of training of highly qualified personnel for the universities, research institutes, medical companies and facilities, and pharmaceutical and biotechnology industries. ... Each of FBB students is to successfully complete and defend three yearly research projects, in bioinformatics, biochemistry, and bioengineering. ...

Еще в разделе: (Показать все результаты (>3) - en.fbb.msu.ru/ )

• BackgroundтАФ Faculty of Bioengineering and Bioinformatics, MSU
• Faculty of Bioengineering and Bioinformatics, Lomonosov Moscow State University

... ECOLOGY Present-Day State of Coral Reefs of Nha Trang Bay (Southern Vietnam) and Possible Reasons for the Disturbance of Habitats of Scleractinian Corals D. S. Pavlov1,3,4, A. V. Smurov2,3, L. V. Il'yash3, D. N. Matorin3, N. A. Kluyev1, S. V. Kotelevtsev3, V. S. Rumak4,1, and T. G Sampling of bottom sediments and biological objects, as well as photo and video shooting, were performed during scuba diving. ... The location of stations in Nha Trang Bay, 1990­2002. ... River sediment No. ...

Еще в разделе: (Показать все результаты (>41) - library.biophys.msu.ru/ )

• http://library.biophys.msu.ru/matorin/3404.pdf
• http://library.biophys.msu.ru/matorin/3410.pdf
• http://library.biophys.msu.ru/matorin/3414.pdf

Preconcentration Laboratory . Laboratory of Chromatography . ... Laboratory of Kinetics Methods of Anaysis . ... Sorption-spectroscopy methods for determination of organic . ... Room-temperature ionic liquds, computational chemistry . ... New detection methods in ion and ion-pair chromatography . ... For that purpose, methods of selective preconcentration are developed along with the methods of determination of analytes directly in the sensing film or in the permeate after membrane diffusion. ...

Еще в разделе: (Показать все результаты (>30) - analyt.chem.msu.ru/ )

Alexander P. Seyranian . Institute of Mechanics , . Moscow State Lomonosov University , . ... Phone: (7495) 939 2039 . Fax: (7495) 939 0165, 939 2065 . ... My field of specialization are Stability Theory, Parametric Resonance, Gyroscopic Stabilization, Mechanics of Solids, Structural Optimization, Singularities and Bifurcations. ... Technical University of Denmark . Aalborg University, Denmark . ... Institute of Engineering Mechanics and Systems, University of Tsukuba, Japan . ...

Еще в разделе: (Показать все результаты (>3) - seyranian.imec.msu.ru/ )

Irena Lasiecka ( University of Virginia ) . Nikolai Melnikov (CEMI / MSU) . Mikhail Zelikin (MSU / Steklov Institute) . G. Avalos ( University of Nebraska , USA ) . V. Borisov (MSU, Moscow) . ... O. Emanouvilov ( Colorado State University , USA ) . A. Fursikov (MSU, Moscow) S. Hansen ( Iowa State University , USA ) R. Hildebrand ( Joseph Fourier University , France) V. Komornik ( University of Strassburg, France ) A. Kowalewski ( Institute of Automatics, Poland ) . ... Moscow) . ...

Еще в разделе: (Показать все результаты (>2) - oc.cs.msu.su/ )

Sergey Vladimirovich Petrushanko Afflilation and official address: Skobeltsyn Institute of Nuclear Physics , Lomonosov Moscow State University Leninskiye Gory, Moscow 119991, Russia E-mail: sergeant@mail.cern.ch Date and place of Birth: 24 March 1975, Sverdlovsk (USSR) Citizenship: Russian Federation Education: 2002 Ph.D. (High energy physics ) Skobeltsyn Institute of Nuclear Physics , Lomonosov Moscow ...

Еще в разделе: (Показать все результаты (>57) - lav01.sinp.msu.ru/ )

• http://lav01.sinp.msu.ru/~vlk/UPC_2002.pdf
• Home Page of A. Snigirev
• Etapi- Comments 3/1/97