... M.V.Lomonosov Moscow State University Department of Physics, . ... 5-th All-Russian Conference . Nitrides of gallium, indium and aluminum: structures and devices " . ... Four All-Russian Conferences "Nitrides of Gallium, Indium and Aluminum: structures and devices" took place in Russia during 2001-2005 (in Moscow and St.-Petersburg). The conferences enjoyed the support from RFBR and the Ministry of Industry and Science. ... Nitrides of Gallium, Indium and Aluminum: structures and devices". ...

Еще в разделе: (Показать все результаты (>2) - www.ccl.msu.su/ )

• 5-th All-Russian Conference - Timetable

LA FACULTи de science politique DE L'UNIVERSITи LOMONOSOV DE MOSCOU Le doyen ИxИcutif, docteur es sciences historiques, le professeur Andrei Shutov La facultИ de science politique de l'UniversitИ Lomonosov de Moscou Иtait crИИe en 2008 par l'ordre du recteur V.A.Sadovnichi, l'acadИmicien de l'AcadИmie des Sciences de la Russie en vertu de la dИcision du Conseil acadИmique de l'UniversitИ. ... Dans la premiХre moitiИ du XIX siХcle l'UniversitИ comptait une facultИ des sciences morales et politiques. ...

Еще в разделе: (Показать все результаты (>15) - polit.msu.ru/ )

• http://polit.msu.ru/pub/fl-doc/Spanish.doc
• Профессор Елена Борисовна Шестопал приняла участие в конференции Кембриджского

New Series of Editions from the History Faculty of MSU . ... Historical Research . ... Through the publication of programs of general courses, the History Faculty of MSU opens a series of works designed to reflect the results of the most important research currently being conducted within the faculty, as well as to represent the experience gained through the teaching of historical disciplines. ... The first series of works published by the History Faculty of MSU is "Historical Sources". ...

Еще в разделе: (Показать все результаты (>368) - www.hist.msu.ru/ )

• The Laboratory of Historical Information Sciences

... Международные: . ... NICA-MPD . МЕЖДУНАРОДНЫЕ ПРОЕКТЫ. ... российский коллайдер протонов и тяжелых ионов, строящийся с 2013 года на базе Лаборатории физики высоких энергий (ЛФВЭ) им. В. И. Векслера и А. М. Балдина Объединенного института ядерных исследований (ОИЯИ), в городе Дубна Московской области. ... Ускорительный комплекс создается с целью исследования области физики частиц в ранее недоступной области параметров и условий эксперимента ? ...

Еще в разделе: (Показать все результаты (>27) - silab.sinp.msu.ru/ )

... Институт . ... Студентам . Приветствуем вас на Официальном сайте Русско-германского института науки и культуры. Published by admin on April 6, 2016 under Новости . ... No Comments ? ... 09.00 - 15.30 љ љљ 736 - 1.ГУМ . ... Морозова Е.Б. пн. љ17-00? 18-30, 18-45?20-15, 20-30?21-15љ 1 к., ауд.736 1 ГУМ . ... Башкиров В. М. вторник 15.00-17.00, четверг љ15.00-17.00, 1 ГУМ ауд.736 . вторник 17.00-19.00, пятница 17.00-19.00 1 ГУМ ауд.736 . ... 736 1 Гум) . ... 7361 Гум) . ... December 2011 . ...

Еще в разделе: (Показать все результаты (>2) - rgi.msu.ru/ )

... For physics faculty . ... Number of lecturers and Professors: 28. ... Head of the Department : prof. D.R. Khokhlov. ... D.R. Khokhlov Doctor of Sciences (Physics and mathematics), Professor, Correspondent Member of the Russian Academy of Sciences. ... B.A.Strukov Doctor of Physics and Mathematics, Professor. ... Field of science activity: magnetic properties of solid state, rare earth magnets, itinerant magnetism, magnetic phase transitions . ... Head of the laboratory of Magnetic Semiconductors. ...

Еще в разделе: (Показать все результаты (>36) - ferro.phys.msu.ru/ )

• Physics Department of Moscow State University
• Department of General Physics and magneto-ordered matter. Physics Department of

. Лаборатория биофизики клетки: Объявления о семинарах и др. / . archives . Правка . Недавние изменения . Настройки . You need to use the ikiwiki-calendar program to generate calendar-based archive pages. Ссылки: sidebar . Редактировалось в последний раз Sun Oct 11 21:47:07 2015

Еще в разделе: (Показать все результаты (>5) - cell.biophys.msu.ru/ )

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>10) - mouse.genebee.msu.ru/ )

Uneex . SeminarFeature . ... Определение спама как нежелательной почты в противовес массовой рассылке . Классические методы защиты от спама и их недостатки . ... Методы, основанные на поведении спамера: Greylisting , TMDA и т. п. Основной источник спама, обходящего классические методы защиты . ... Общая схема построения (feature-based) классификаторов . ... Copyright 2003 by the contributing authors. ... Send feedback to svv at cmc dot msu dot ru. ...

Еще в разделе: (Показать все результаты (>5) - uneex.cs.msu.su/ )

... High Power Linear Accelerators . Fig 3a: One-section schematic . ... Our CW LINAC family consists of ten accelerators each with beam currents of 50 mA and energies ranging from 0.6 to 6 MeV in increments of 600 keV with corresponding beam power of 30 to 300 kW. ... Fig 4a: Two-section schematic . ... Our two-section CW LINAC seen in Fig. 4 consists of one-section CW LINAC, beam line between first and second AS, and second AS which accelerates the 50 mA beam up to the energy 1.2 MeV. ... 0.6 MeV . ...

Еще в разделе: (Показать все результаты (>4) - vserv.sinp.msu.ru/ )

• RTM-CS

... Форумы > Аспирантура > Тема . Автор темы ter . Форумы Список тем Новая тема . ... PhD positions in logic and AI, Vancouver (Canada) . PhD positions are available in the area of logic-based artificial intelligence. ... interested in logic (or discrete mathematics) and its uses for practical problem solving. ... Online application information is available at: . ... Следующая тема Предыдущая тема . ... Сайт работает с 29.08.2000, Copyright 2000 2011 MMOnline.Ru and MMForce.Net, . ...

Еще в разделе: (Показать все результаты (>89) - www.mmonline.ru/ )

• MMOnline | Форумы | Разное | Требуется Web - дизайнер.

. Научная Библиотека . Отдел Обслуживания Физического Факультета МГУ . Water and Environment Journal . Weed Biology and Management . Weed Research . Winterthur Portfolio . WorkingUSA . World Banking Abstracts . World Englishes . World Oil Trade . Worldviews on Evidence-Based Nursing . Wound Repair and Regeneration . (495) 939-16-96, 939-42-04 . Copyright ї 2004 mailto:lib@phys.msu.su . Научная Библиотека Физического факультета МГУ имени М. В. Ломоносова . Разработано EA Studio .

Еще в разделе: (Показать все результаты (>5) - wwwlib.phys.msu.ru/ )

... Phone: (007) 095-9395197; fax: (007) 095-9395888; e-mail: e@lav01.sinp.msu.ru . ... The term of training - 1-2 years. ... Physics of quark-gluon mesons spectroscopy? ... Scientific chief - Ludmila Ivanovna Sarycheva, professor of the Chair of Cosmic Rays and Physics of Cosmos and leader of Laboratory of Hadron Interactions of SINP MSU senior science researcher, PhD. ... Simultaneously the problem of the solar cosmic ray flare energetic electron sources in the interplanetary space will be studied. ...

Еще в разделе: (Показать все результаты (>27) - foroff.phys.msu.ru/ )

• Postdoctoral training (Neutronography)

... Resources . ... Eurasian Center . for Food Security . Home About About Eurasian Center for Food Security . ... Our mission: €аPromote and coordinate collective actions for strengthening food security in Eurasia through research and development. ... The ECFS Mission should be creating conditions for the development and implementation of a coherent agricultural policy that ensures soil fertility, conservation of natural resources and ensuring food security of the Eurasian region. ...

Еще в разделе: (Показать все результаты (>62) - ecfs.msu.ru/ )

• Draft Plan of Action for Eurasian Subregional Partnership | ECFS
• Director | ECFS

Published on Department of the Automation for Scientific Research CMC MSU ( http://ani.cmc.msu.ru ) . ... Alexander Valeryevich POZDNEEV (November 22, 1983, Novosibirsk, Russia) тАФ teaching assistant (assistant professor). Graduated with honours from the Faculty of Computational Mathematics and Cybernetics (CMC) at Lomonosov Moscow State University (MSU) (2006). Succesfully completed postgraduate study at the Faculty of CMC at Lomonosov MSU (2009). ... A.V. Pozdneev. ...

Еще в разделе: (Показать все результаты (>15) - ani.cmc.msu.ru/ )

• Alexander Valeryevich Pozdneev | Department of the Automation for Scientific
• Alexander Pozdneev at the ASMS 2008 Conference | Department of the Automation
• Alexander Pozdneev at the ASMS 2008 Conference

... This article caused a most lively interest from the readers, and received more than a hundred responses, which contained various versions of construction methods of the Sri Yantra. ... In this way he revealed a good correspondence between the concentric levels built by him in this relationship of the three Sri Yantra and the orbits of the planets of the solar system (Fig. 10, shows the first two out of three stars examined by him) with a divergence from the real diameters of orbits of about 1.5%. ...

Еще в разделе: (Показать все результаты (>12) - www.protein.bio.msu.ru/ )

• http://www.protein.bio.msu.ru/~akula/JourVND1104007KulaichevLO.pdf

... Anatoliy A.Polikarpov . ... Basing on the assumption of basic semantic micro- processes do minating in the history of any word meaning is possible to predict [Polikarpov, 1988; 1990; 1991; 1993; 1994; 1995] and to test ... Kapitan, 1994; Breiter, 1994; Breiter, Polikarpov, 1997; Savchuk, 1997] some most probable directions for the derivative micro- processes (e.g., change of some semasiological and word-formational parameters of a word) and for macro- evolution of a ...

Еще в разделе: (Показать все результаты (>66) - old.philol.msu.ru/ )

• Melnikov G.P.- Systemology and Linguistic Aspects of Cybernetics
• Dmitry V. Khmelev: List of Publications
• Basic Assumptions about a Sign's Life Cycle for Mathematical Modelling of

... Nonlinear fiber optics . ... member of the Editorial Board for the Laser Physics journal . ... Member of the steering committee of the international conference on Raman spectroscopy (ICORS): Budapest, 2002; Brisbane, 2004; Yokohama, 2006; London, 2008 . Member of the steering committee of the International Laser Physics workshop: Bratislava, 2002; Hamburg, 2003; Trieste, 2004; Kyoto, 2005; Lausanne, 2006; Leon, 2007; Trondheim, 2008; Barcelona, 2009 . ... International conference ?Laser Optics? ...

Еще в разделе: (Показать все результаты (>46) - photonicslab.phys.msu.ru/ )

• Neurophotonics
• Nonlinear optics of ionized mediums
• Conferences

... MPI_Win_fenc win); A[rank] = 4; MPI_Win_fenc win); MPI_Put ( .. ... MPI-2 I/O: MPI - -, , - , MPI « » - , , . ... int MPI _File_close( MPI_File *fh) INOUT fh () , fh , fh, , MPI _FILE_CLOSE int MPI _File_set_view( MPI_File fh, MPI _ Offset disp, MPI_Datatype etype, MPI_Datatype filetype, char *datarep, MPI _Info info) I I I I I I N N N N N N OUT fh () disp () etype () filetype () datarep () info () int MPI _File_get_view( MPI_File fh, MPI _ Offset *disp, MPI_Datatype *etype, ...

Еще в разделе: (Показать все результаты (>4) - angel.cmc.msu.ru/ )

• http://angel.cmc.msu.ru/~basrav/files/publications.pdf

COACHES . ... Kiseljev Dmitri . Head Coach . ... Lukyanchikov Dmitri . First Base coach, Power Lifting coach . ... Komissarov Dmitri . 3rd Base coach, Power Lifting coach . ... Erjemkin Alexey . ... Chichaev Ivan . ... Rich Reddrop* . ... Frolikov Alexey . ... Kudrjashov Alexander . ... Chichaev jr . ... Ned Reddrop* . ...

Еще в разделе: (Показать все результаты (>4) - mguteam.chat.ru/ )

• http://mguteam.chat.ru/komiss1.html