Educational Technology & Society 10(3) 2007 ISSN 1436-4522 : .. . ... 1995). . ... Education Technology & Society 9(1) 2006 pp. 422-427. [ .., 1993] . ... Education Technology & Society 5(1) 2002, pp 222-243. ... Brusilovsky P., 1995] Brusilovsky P. Intelligent learning environments for programming: The case for integration and adaptation // In: J. Greer (ed.) Proceedings of AI-ED'95, 7th World Conference on Artificial Intelligence in Education, Washington, DC, 16-19 August 1995, AACE, pp. ...

Еще в разделе: (Показать все результаты (>179) - www.psy.msu.ru/ )

• http://www.psy.msu.ru/science/psyrussia/2013-2/kaczmarek_2013_2.pdf
• http://www.psy.msu.ru/science/psyrussia/2009/kashapov.pdf
• Psychology in Russia: State of the Art, Vol. 1, 2008

... Sections . ... Atlas "Birds of Moscow City" . ... Breeding bird atlas of European Russia . ... Annual report, issue 1 . ... The Fauna and Abundance of European Russia Birds", issue 1 . ... Br eeding bird atlas of European Russia . ... Project outputs : Accurate mapping of Russian birds in the 2nd European Breeding Bird Atlas, and a groundbreaking Atlas of Breeding Birds of European Russia . ... Atlas "Birds of Moscow City" Monitoring of common birds Breeding bird atlas of European Russia . ...

Еще в разделе: (Показать все результаты (>976) - zmmu.msu.ru/ )

• Section of the scientific public oriented projects
• Monitoring of common birds
• Exhibition

... Voronin А. Каrmanov D. Savin А. Electronic engineer: . ... Engineer ? ... Electrical design of microprocessor systems, creating software for control and monitoring earth and satellite stations. ... Programming, electrical and layout design of test equipment for testing the silicon matrix for experiment ATIC (Advanced Thin Ionization Calorimeter), creating software for calibration. Electrical design of readout electronics, creating software for collecting and analysis data for experiment NUCLEON . ...

Еще в разделе: (Показать все результаты (>3) - silab.sinp.msu.ru/ )

MEIS : ­ 2007 ­ 3/802 537.9 538.975 P.N.Chernykh, G.A Iferov., ... S. Abo, S. Ichihara, T. Lohner, F. Wakaya, T. Eimori, Y. Inoue, M. Takai, Nuclear Instruments and Methods in Physics Research B237 (2005) 72. ... D.P.Woodruff, Nuclear Instr. and Methods in Phys. Research B256 (2007) 293. ... T.Gustafsson, H.C. Lu, B. W. Busch, W. H. Schulte, E. Garfunkel, Nuclear Instr. and Methods in Physics Research B183 (2001) 146. ... L.R. Doolittle, Nuclear Instr. and Methods in Physics Research B9 (1985) 344. ...

Еще в разделе: (Показать все результаты (>144) - danp.sinp.msu.ru/ )

• http://danp.sinp.msu.ru/Articles_GSIB/nimb206_838_Yamada_GCIB_CollisionsSolid.pdf
• http://danp.sinp.msu.ru/LIIWM/JPhysA39_2006_4775Pokhil.pdf
• http://danp.sinp.msu.ru/Articles_GSIB/nimb_gasclasterionbeam_aplications.pdf

... Положение об олимпиаде . ... Отборочный этап . ... от Оргкомитет олимпиады школьников "Ломоносов" - Четверг, 25 Февраль 2016, 12:10 . ... от Оргкомитет олимпиады школьников "Ломоносов" - Среда, 3 Февраль 2016, 18:52 . ... от Оргкомитет олимпиады школьников "Ломоносов" - Понедельник, 1 Февраль 2016, 17:12 . ... Оргкомитет олимпиады школьников ?Ломоносов? приглашает вас к сотрудничеству с целью организации и проведения заключительного этапа Олимпиады на вашей базе по различным профилям. ...

Еще в разделе: (Показать все результаты (>3) - olymp.msu.ru/ )

... Scientific educational events were organized at the Chair and the Faculty in the framework of the All-Russian School RESEARCH AND EDUCATIONAL PROJECTS on Global Social and Natural Processes in Interdisciplinary AND ACTIVITIES Studies as a joint action with the MSU Youth Council on Federal Task Program aimed at the inclusion of young Scientific research studies done by students of people in the scientific educational innovation processes the Chair and the Faculty were praised at the in Russia. ...

Еще в разделе: (Показать все результаты (>90) - fgp.msu.ru/ )

• http://fgp.msu.ru/wp-content/uploads/2014/09/UNESCO_CHAIR-1.pdf
• http://fgp.msu.ru/wp-content/uploads/2013/12/Luce_Moscow_2013_small.pdf

4 SPIN. ... 0 1 Hello, world! ( ) ";" , active proctype main() { printf("Hello, world!\n") } ­ , >spin hello.pml Hello, world! 1 process created Hello, world! ... mtype = { P, C }; mtype turn = P; active proctype producer() { do :: ( turn == P) - printf( Produce\n ); turn = C od } active proctype consumer() { do :: ( turn == C) - printf( Consume\n ); turn = P od } ( 1) ­ 0, (op on sequence) (guard) ­ mtype = { P, C }; mtype turn = P; active proctype producer() { do :: ( ...

Еще в разделе: (Показать все результаты (>4) - savenkov.lvk.cs.msu.su/ )

• http://savenkov.lvk.cs.msu.su/mc/lect02.pdf

... MSU Chamber Orchestra . ... Chamber Orchestra of Moscow State University was born in 1967. ... It was originally formed as a chamber orchestra at the School of Mathematics and Mechanics but soon (since September 1967) transformed into a Chamber Orchestra of the Moscow State University. ... The Chamber Orchestra of Moscow State University won the first prizes in the 1-st and 2-nd All-Union festivals of non-professional arts. ... Moscow State University does not have its own School of Music. ...

Еще в разделе: (Показать все результаты (>73) - music.genebee.msu.ru/ )

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>4) - mouse.genebee.msu.ru/ )

... Программы обучения . ... Пропустить категории курсов . ... Пропустить новости . ... от Администратор ЦДО Ф/Ф МГУ - Понедельник 4 Август 2014, 09:53 . 04 августа 2014 года в Интеллектуальном центре ? ... Российские ВУЗы все чаще переходят на дистанционное обучение . ... ДИСТАНЦИОННЫЕ ПОДГОТОВИТЕЛЬНЫЕ КУРСЫ ФИЗИЧЕСКОГО ФАКУЛЬТЕТА МГУ ПО ФИЗИКЕ И МАТЕМАТИКЕ Пропустить Страницы ЦДО в социальных сетях . ... Центр дистанционного образвания физического факультета МГУ им. М.В. Ломоносова 2007-2012 . ...

Еще в разделе: (Показать все результаты (>53549) - distant.phys.msu.ru/ )

• Уведомление

. Summary of experimental results . The light absorbing capacity of phytoplankton, estimated from Fo , and its photosynthetic activity (estimated as Fv/Fm ) are key characteristics of the primary processes of photosynthesis. We suggested a formula for calculation of the primary production of phytoplankton from these two characteristics and underwater irradiance. The probing data were used to plot vertical profiles of phytoplankton productivity in various regions of the Baltic, Norwegian, and South China

Еще в разделе: (Показать все результаты (>14) - www.biophys.msu.ru/ )

... Electronic journal Issue 4. 10 september 2004 Leigh E. Making Learning a Game Introduction. As a university lecturer I enjoy playing games with learning goals in mind. My students are all adults who work in many different roles. ... Their needs include learning how to design activities that will support acquisition of practical skills, extend personal understanding of emotional factors, and improve awareness of factors ­ such as economic, ecological and political aspects of society. ... Play. ...

Еще в разделе: (Показать все результаты (>8) - e-journal.spa.msu.ru/ )

• http://e-journal.spa.msu.ru/uploads/vestnik/2004/vipusk_4._sentjabr_2004_g./bonham_surin.pdf
• http://e-journal.spa.msu.ru/uploads/vestnik/2004/vipusk_4._sentjabr_2004_g./vorontchuk.pdf

О НЕУСТОЙЧИВОСТИ СХОДЯЩИХСЯ УДАРНЫХ ВОЛН ПОЛИГОНАЛЬНОЙ ФОРМЫ А.В. Конюхов, А.П. Лихачев Объединенный институт высоких температур РАН, Москва Как известно [1], сходящиеся цилиндрические (сферические) ударные волны неустойчивы по отношению к потере пространственной симметрии с тенденцией к возникновению полигональной (полиэдральной) формы. ... Whitham, G. B., 1974 Linear and Non-linear Waves. ... Schwendeman, D. W., Whitham, G. B. On converging shock waves // Proc. R. Soc. ...

Еще в разделе: (Показать все результаты (>21) - hit-conf.imec.msu.ru/ )

RAPID COMMUNICATIONS PHYSICAL REVIEW A, VOLUME 62, 011802 R High-intensity pulsed source of space-time and polarization double-entangled photon pairs Yoon-Ho Kim,* Sergei P. Kulik, and Yanhua Shih Department of Physics, University of Maryland, Baltimore County, Baltimore, Maryland 21250 Received 4 April 2000; published 13 June 2000 Two spatially separated type-I nonlinear ... Two orthogonally oriented type-I BBO crystals are placed collinearly and pumped by 45° polarized femtosecond pulses. ...

Еще в разделе: (Показать все результаты (>86) - qi.phys.msu.ru/ )

• http://qi.phys.msu.su/papers/2006-jetp(e)-102-712.pdf
• http://qi.phys.msu.su/papers/2005-jetp(e)-100-521.pdf
• http://qi.phys.msu.ru/kulik/Papers/JETP10_02BurlakovLO.pdf

... Grants . ... 2004 . ... i) Physical model of molecular machines based on the Kolmogorov-Fokker-Planck equations. (ii) Theoretical model of the 2D and 3D Brownian motion for simulation of protein dynamics in water. (iii) Stochastic, probability, and spectrum characteristics of the Brownian motion obtained using numerical methods and computer simulation. (iv) Raman spectroscopy data on enzyme (chymotrypsin) and enzyme-substrate complex and their interpretation using numerical and analytical results. ...

Еще в разделе: (Показать все результаты (>113) - ilc.phys.msu.ru/ )

• Грант подробно
• Laboratory of Nonlinear Spectroscopy of Ultrafast Processes in Condensed Matter
• Conference on Photo-Excited Processes and Applications

... M.V.Lomonosov Moscow State University Department of Physics, . ... 5-th All-Russian Conference . Nitrides of gallium, indium and aluminum: structures and devices " . ... Four All-Russian Conferences "Nitrides of Gallium, Indium and Aluminum: structures and devices" took place in Russia during 2001-2005 (in Moscow and St.-Petersburg). The conferences enjoyed the support from RFBR and the Ministry of Industry and Science. ... Nitrides of Gallium, Indium and Aluminum: structures and devices". ...

Еще в разделе: (Показать все результаты (>2) - www.ccl.msu.su/ )

Synthesis and Use of Humic Derivatives Covalently Bound to Silica Gel for Np(V) Sequestration I.V. Perminova , L.A. Karpiouk, N.S. Shcherbina*, S.A. Ponomarenko§, St.N. Kalmykov, and K. Hatfield Department of Chemistry, Lomonosov Moscow State University, Moscow 119992, Russia Vernadsky Institute of Geochemistry and Analytical Chemistry, Russian Academy of Sciences, Moscow 119991, Russia § Institute of Synthetic Polymer ... I.V. Perminova, et al. ...

Еще в разделе: (Показать все результаты (>142) - mgumus.chem.msu.ru/ )

• http://www.mgumus.chem.msu.ru/publication/2010/2010-kazachkov-optimization.pdf
• http://www.mgumus.chem.msu.ru/publication/2012/2012-karpiouk-self.pdf
• http://www.mgumus.chem.msu.ru/publication/2008/2008-kholodov-retention.pdf

... UHECR SINP MSU . ... News . ... TUS Ultra high energy cosmic ray detector on-board the Lomonosov satellite . ... According to existing estimations it can be a prominent source of ultra high energy cosmic rays (UHECR). ... In either case, the newly born magnetar is an attractive site for producing ultrahigh-energy cosmic rays (particles with individual energies exceeding 10 18 e V ; UHECRs). ... A new mechanism for the acceleration of ultra high energy cosmic rays (UHECR) is presented here. ...

Еще в разделе: (Показать все результаты (>18) - uhecr.sinp.msu.ru/ )

• Новости КЛПВЭ

The Astronomical Journal welcomes new submissions at IOP Publishing . ... From: Andrew Wray < andrew.wray@iop.org > . ... On behalf of the IOP-AAS Project Team, I am delighted to announce that IOP Publishing is now processing all new submissions to the AJ. Submitting a new article . To submit a new article to the journal, go to http://authors.iop.org/aj , where you will find our beta version of the new AJ web submission site. ... Refereeing an article . ... IOP Publishing . ...

Еще в разделе: (Показать все результаты (>82) - sai.msu.ru/ )

... Institute of Nuclear Physics, . ... I have been directly involved in theoretical and phenomenological analysis -- within the D? collaboration -- devoted to a search for single top quark production in the electroweak processes. ... 1] B. Abbott et al. ... D0 Collaboration], ``Inclusive jet production in p anti-p collisions,'' hep-ex/0011036. ... D0 Collaboration], ``Search for electroweak production of single top quarks in p anti-p collisions,'' hep-ex/0008024. ... Phys.Rev.Lett. ...

Еще в разделе: (Показать все результаты (>9) - top.sinp.msu.ru/ )