Bird Species Database (BSD) is being compiled in a framework of the Arctic Birds Breeding Conditions Survey (ABBCS) of the International Wader Study Group (IWSG). BSD aims at providing information on distribution, numbers and breeding status of birds in the Arctic, with the focus on last-breaking and, thus usually unpublished information. The primary source of data is questionnaires filled in by contributors to the ABBCS, while data from literature are being added occasionally. ... breeding . ...
? ? 1.???????????????? 3 2.Реформа и инновации в сфере государственных услуг в России. 8 3.Особенности развития экономики Шэньчжэня 26 4.в условиях модификации модели роста в КНР 26 5.???????????????? 39 6.СРАВНИТЕЛЬНЫЙ ОПЫТ УЧАСТИЯ РОССИИ И КИТАЯ В ИНСТИТУТАХ ГЛОБАЛЬНОГО УПРАВЛЕНИЯ 41 7.Принципы развития межрегиональных центров подготовки кадров для государственного управления в Российской Федерации 59 8.??????????????? 74 9.Региональные особенности государственного регулирования сферы образования в РФ 82
... кафедра Исследования операций . ... Приветствие Традиционные темы конференции Основные даты Оформление тезисов Регистрация Программа конференции Размещение Программный коммитет Организационный коммитет Координаторы Контактная информация . ... 10-14 апреля 2007 Программа конференции . ... академик РАН А.А. Петров . ... А.В. Кузнецова, В.И.Лукьянов, О.А.Максакова, И.С.Меньшиков, О.Р. Меньшикова, О.В. Сенько . ... секция . ... МГУ, ВМК, ауд. ... 11 апреля 2007 . ... среда, 11 апреля 2007, ауд. ...
. NON-STATIONARY OPERATION OF THE FAST-FLOW LASERS . AND NEW POSSIBILITIES OF CONTROLLING THE LASER OUTPUT CHARACTERISTICS . A.V. Mushenkov, A.Yu.Loskutov, A.I.Odintsov, A.I.Fedoseev and V.F.Sharkov . Physics department of M.V.Lomonosov Moscow State University, 119899, Vorob'evy gory, Moscow, Russia . Abstract . The dynamics of the lasing of the fast crossflow gas laser with the inhomogeneous steady state pumping in the unstable resonator by means of numerical modeling is investigated. Depending on the
... Новости . ... О кафедре . ... Занятия в среду 7.11.2012 по Современным компьютерным технологиям (преподаватель Краев А.В.) на первой паре не состоится и переносится в связи с календарным отпуском преподавателя. ... Автор: Краев Андрей Владимирович 06.11.2012 . ... Будут заслушены доклады Аристова А.И., Карамышевой Т.В., Краева А.В., Будановой А.В. Автор: Фурсов Андрей Серафимович 27.10.2012 . ... Colin Angle - основателя и руководителя компании iRobot, крупного специалиста в области робототехники. ...
Кафедра общей топологии и геометрии . ... Публикации . ... Сипачева О.В. , The Topology of Free Topological Groups, Journal of Mathematical Sciences, vol. 131, no. 4, 2005, pp. ... Сипачева О.В. , Топология свободной топологической группы, Общая топология и топологическая алгебра. ... Резниченко Е.А. , Сипачева О.В. , The Fr\'echet--Urysohn and $\alpha_2$-properties in separable spaces, groups, and locally convex spaces, 13th Summer Conf. on General Topology and Its Applications, Mexico, 1998, pp.~ ...
... Symposium expenses . ... Abstract submission . ... 14 European Symposium on . Gas Phase Electron Diffraction . ... The deadline for abstract submission is 20 April, 2011. The abstracts have to be sent to the Symposium web address: ed.mos2010@gmail.com . ... Arial font and single spacing should be used throughout. The title should be centered and set with 14-point bold font style. ... The main body of text should be fully justified and set in 12-point regular font style. ...
русский english MSU of Lomonosov Higher School . of Policy in Culture . and Administration in Humanities (faculty) . ... Programs . ... Faculty in the people . ... Two Master?s programs are carried out at the faculty ? ... In 2012 Lomonosov Moscow State University received the license to carry out educational activities with a specialization 074301 Producer?s Business . ... Higher School of Policy in Culture and Administration in Humanities (faculty Lomonosov Moscow State University) 2016 . ...
... Москва и 'Москва' Андрея Белого: Сборник статей / Отв. ред. ... Профессор Коробкин и профессор Бугаев (К жанровой характеристике романа 'Москва' Андрея Белого). ... С. 29-44; Каухчишвили Н.М. Андрей Белый и Николай Васильевич Бугаев. С. 45-57; Рицци Д. 1911 год: к истокам 'московского текста' Андрея Белого. С. 58-66; Казари Р. 'Старый Арбат' Андрея Белого в связи с традицией литературных панорам Москвы. ... Даугавпилс, 1997. - 180 с. Andrej Belyj: Symbolismus, Anthroposophie, Ein Weg. ... Вып. ...
Open Conference Systems . Conference Help . ... All Authors Title Abstract Index terms Full Text . ... Call for Papers (March 1, 2016 - June 1, 2016) . ... By Conference . ... It is incumbent on the authors to obtain appropriate approval to present their work to this international forum. 35-word Abstract : Your abstract should be a brief summary of your paper topic. If your paper is accepted, your 35-word abstract will be included in the Conference Program and the Technical Digest on CD-ROM . ...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
... О кафедре . English . ... Department for Jewish Studies of Lomonosov Moscow State University . ... The Department for Jewish Studies (DJS) was established in 1998. ... The students take courses offered by the School (the Institute of Asian and African Studies), as well as courses offered by the Jewish Studies Department. ... The Department regularly accepts university teachers of Jewish and Israeli Studies from Russia and the FSU in order to upgrade their professional level. ...
... Публикации . ... 1, 012506 DOI . ... 1, 012509 DOI . ... 1, 103598 DOI . ... Edge field emission of large-area single layer graphene Kleshch V.I., Bandurin D.A., Orekhov A.S., Purcell S.T., Obraztsov A.N. Applied Surface Science, Elsevier BV (Netherlands) DOI . ... Graphene Formation on Surfaces of Single Crystal Metals Shvets P.V., Soon J.M., Verger A., Obraztsov A.N Journal of Nanoelectronics and Optoelectronics, American Scientific Publishers (United States) DOI . ... Материалы, ? ...
... On-line консультант . ... В преддверии нового учебного года Группа компаний КомпьюЛинк и Факультет Вычислительной математики и кибернетики МГУ имени М.В. Ломоносова провели день открытых дверей по магистерской программе Информационные системы управления предприятием . ... Основная цель программы - подготовка специалистов по организации и проведению проектов внедрения ERP-систем на отечественных предприятиях, а также дальнейшей эксплуатации таких систем. ... Дополнительная информация: www.gmcs.ru . ...
... Рощин Алексей/ Roshchin Alexei, 2 курс, Public sector of the Russian economy in the post-Soviet period/ Государственный сектор экономики России в пост-советский период. ... Венгеров Максим, 2 курс, Education in Africa. ... Мария Лагузова, 2 курс, The problem of Internet and Social networks in the modern World. ... Красильникова Анастасия, 2 курс, Political technologies at the elections in the 1990s in Russia/ Политтехнологии избирательных кампаний 90-х годов в России. 12.15-13.00 - перерыв 1. ...
... C olumn S et C olumn V alues , . ... C olumn Add N ew C olumns C (Y ). ln(col(B )) C olumn S et C olumn V alues. , sq rt() Add F unction, col(B ) Add C olumn. , 1/, 1/sq rt(col(B )), OK . ... ln() Add F unction. col(B ) Add C olumn. ... Shift 3 C 6,0 5,5 Y Axis Title 5,0 4,5 4,0 350 400 450 500 550 600 650 X Axis Title . ... Layer . ... 0,8 B 20000 15000 Y Axis Title 10000 5000 0 0 200 400 600 800 1000 X Axis Title . ... 14 B 1400 1200 1000 Y Axis Title 800 600 400 200 0 200 400 X Axis Title 600 800...
[
Текст
]
Ссылки http://prac-gw.sinp.msu.ru/images/nucleus/descriptions%20nucleus/Obrabotka.pdf -- 1101.6 Кб -- 24.10.2013 Похожие документы
... There are corresponding results showing that the Poincare duals of certain totally ge odesic cycles, which we will call "special cycles", span a definite part (a refined Hodge component) of the cohomology of the locally symmetric spaces of standard arithmetic type associated to the orthogonal groups O(p, q). ... Math. ... KLM3] (with B. Leeb and M. Kapovich) The generalized triangle inequalities in symmetric spaces and buildings with applications to algebra, Memoirs of the AMS, Vol. ...
[
Текст
]
Ссылки http://www.dubrovinlab.msu.ru/files/Alltogether.pdf -- 334.8 Кб -- 15.09.2012
[
Текст
]
Ссылки http://dubrovinlab.msu.ru/files/Alltogether.pdf -- 334.8 Кб -- 15.09.2012 Похожие документы
... Voronov, Vasiliy. Scalability and efficiency of parallel power grid simulations on massively-parallel platforms (submitted). ... 2009. ... Voronov, Vasiliy and Popova, Nina. ... Conference proceedings 2010. ... Abstract Book of SIAM Conference on Parallel Processing for Scientific Computing (SIAM PP10). ... Proceedings of the International Conference on Parallel Computing (ParCo-2009). ... IEEE Computer Press. ... Pozdneev, Alexander and Popova, Nina and Voronov, Vasiliy. ...
... Radical changes in the life of the country at the end of the twentieth century put the Moscow University within the need of maintaining a high level of classical university education in the new environment. ... In June 2006 the Academic Council of the Moscow State University has decided to establish a new Faculty - Higher School of Management and Innovation (Corporate University) - jointly with JSFC "Sistema" . ... MSU website . ... 2006-2016 MSU Higher School of Management and Innovation. ...
Lomonosov Moscow State University FACULTY OF ARTS 2011 ALEXANDER LOBODANOV DEAN OF THE FACULTY OF ARTS WxtЊ vҐЂЂxtzтxс4 g{x YtvтЂрч Ґy TЊрс уxЊx tvvx¶рxw |° ... Since 2003 he has been chairman of the Department of Semiotics and the General Theory of History, founded by him, the first of its kind in Europe. ... Department of Semiotics and the General Theory of Arts The Department of Semiotics and the General Theory of Arts is a theoretical department. ... Galina Zadneprovskaya manages this department. ...