30 TH I NT E R N AT I ON AL C OSMIC R AY C O N F ER EN C E Search for global asymmetry of UHECR arrival directions with the TUS space detector P. K LI M OV 1 ,O. K AL ASHE V 2 , B . ... Introduction Space-based ultra-high-energy cosmic-ray detectors such as TUS or JEM/EUSO are best suited for searches of the global anisotropies in the distribution of arrival directions of cosmic-ray particles because they provide full-sky coverage with a single experiment. ... Phys. 12, 25 (1999). ... Phys. Lett. ...

Еще в разделе: (Показать все результаты (>3) - cosrad.sinp.msu.ru/ )

• http://cosrad.sinp.msu.ru/experiments/tus/doc/Ponce2007fin.pdf

... 2005 . ... 2003-2004 . ... Virtual Los Angeles", 1994-1995 UST (Urban Simulation Team) . ... Liggett R., Friedman S., Jepson W., Interactive Design/Decision Making in a Virtual Urban World: Visual Simulation and GIS, 1996 // http://www.aud.ucla.edu/~robin/ESRI/p308.html 14. ... Urban Simulation Team // http://www.ust.ucla.edu/ustweb/projects.html 50.The Development of the Temple of Karnak1 // http://dlib.etc.ucla.edu/projects/Karnak/assets/media/resources/ ProcessionalRoutesAndFestivals/guide.pdf 51...

Еще в разделе: (Показать все результаты (>226) - hist.msu.ru/ )

• Зарубежные Web-ресурсы по экономической истории
• IV Russian
• Work incentives: Yaroslavl workshop program

... 7.1] Lectures of prof. Scrucca in Advanced quantum field theory (e.g., for the first study of the worldline formalism): http://itp.epfl.ch/webdav/site/itp/users/181759/public/aqft.pdf . ... I. Topological quantum effects Lecture 1 (Spring 2015) , The Outline Before Casimir: the van der Waals forces (presentation, pdf) . ... Lecture 5 (Fall 2015) , Lattice field theory: 'free fields' (presentation, pdf) . Lectures 6-7 (Fall 2015) , Lattice field theory: 'interacting fields'. ...

Еще в разделе: (Показать все результаты (>19) - theorphys.phys.msu.ru/ )

... Кафедра системного анализа ВМК МГУ . ... О кафедре . ... на кафедру . ... ВМК . МГУ . ... СМУ ВМК . ... Alexandr Borisovich Kurzhanski) . In Russian . ... Kurzhanski was Elected Associate Member of USSR Academy of Sciences (now changed to Russian Academy of Sciences) in 1981 and Full Member in 1990. He is the Chairman of the Russian National Committee on Automatic Control (the IFAC NMO). ... Chairman of Russian National Committee of Automatic Control. ... 4 (8). pp. 100-118. (in russian). ...

Еще в разделе: (Показать все результаты (>2) - sa.cs.msu.ru/ )

... Пользователи -General- Common Current University Society Study Diaspora FAQ Real Estate -Technical- Development Hard&Soft Network Mobile -Market- Market Services Job -Hobby- Behemoth Health Love&Sex Еда Media Games Auto&Moto Sport Hobby Flood Zone -Servant- Alternative Forums Forum -Garbage- Revolution Garbage Private . ... Рейтинг: 4578 . ladytron-velocifero-(advance)-2008 . ... Re: ladytron-velocifero-(advance)-2008 [ re: SerW ] . ... Re: ladytron-velocifero-(advance)-2008 [ re: kaiserin ] . ...

Еще в разделе: (Показать все результаты (>1804) - www.fds-net.ru/ )

• Настройка RAS в Win2k Advanced Server - Public forum of MSU united student
• win2k Advanced server needed - Public forum of MSU united student networks
• Linux Advanced Routing - Public forum of MSU united student networks

Lomonosov project . ... Personnel . ... Affiliation D.V. Skobeltsyn Institute of Nuclear Physics of M.V. Lomonosov Moscow State University . ... Phone 7 495 939 1818 . ... Phone 7 495 939 5731 . ... Phone 7 495 939 1010 . Fax 7 495 939 0896 . ... Affiliation Moscow State University, Sternberg Astronomical Institute . ... Fax 7 495 939 5063 . ... Institute for Biomedical Problems of the Russian Academy of Sciences, Skobeltsyn Institute of Nuclear Physics of Moscow State University. ...

Еще в разделе: (Показать все результаты (>28) - lomonosov.sinp.msu.ru/ )

• Collaboration | Университетский спутник "Ломоносов"

... The applied mathematics (with Honors), Kazan State University, Kazan, Russia (USSR), 1980. nd Alexander Lazarev Research Interests Discrete optimization: combinatory problems, modeling, decomposition algorithms, applications to production planning and scheduling. ... Kazan, Publishing house of the Kazan mathematical society, 1998. - 285 p. Lazarev A.A., Gafarov E.R. Scheduling Theory. ... Computer centre of the Russian Academy of Sciences - 2006. - 134 p. Lazarev A.A., Gafarov E.R. Scheduling Theory...

Еще в разделе: (Показать все результаты (>2) - physcontrol.phys.msu.ru/ )

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>5) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search
• About

MOSCOW STATE UNIVERSITY INSTITUTE OF PROTEIN RESEARCH, RUSSIAN ACADEMY OF SCIENCES ИНСТИТУТ БЕЛКА The ribosome as a molecular machine: structure and functions. ... Phone: +7(4967)318425 E-mail: nikulin@vega.protres.ru Travel from Moscow: bus 359 from subway station "Yuzhnaya" Biological Faculty of Moscow State University: 119991 Moscow, Leninskie Gory 1, building 12. ...

Еще в разделе: (Показать все результаты (>6) - www.bio.msu.ru/ )

... You can receive guidance from the NIST Library Daemon (nistlibd@cmr.ncsl. nist .gov) by sending email to: nistlib@cmr.ncsl. nist .gov The email message should, for starters, just read: send index Below is the type of email you'll receive from the NIST Library Daemon: (Message 18N, 82 lines, 3495 bytes) From nistlibd@cmr.ncsl. nist .gov Sat Jun 26 19:49:04 1993 Received: from CMR.NCSL ...

Еще в разделе: (Показать все результаты (>246) - www.parallel.ru/ )

• http://www.parallel.ru/sites/default/files/ftp/computers/scali/ScaliFlyer2.pdf
• http://www.parallel.ru/sites/default/files/ftp/computers/sgi/ace.pdf
• http://www.parallel.ru/sites/default/files/ftp/documents/acronyms.pdf

34th Meeting of the German Association for Acoustics (DAGA 2008) March 10 - 13, 2008, Dresden, Germany Deadline for abstract submission: November 1, 2008 . 11th European Mechanics of Materials Conference (MECAMAT) "Mechanics of microstructured solids: cellular materials, fibre reinforced solids and soft tissues" March 10 - 14, 2008, Turin, Italy Deadline for abstract submission: November 15, 2007 . ... 20th International Congress on Acoustics (ICA2010) August 23 - 27, 2010, Sydney, Australia . ...

Еще в разделе: (Показать все результаты (>62) - acoustics.phys.msu.ru/ )

• http://acoustics.phys.msu.su/conf2004.htm
• http://acoustics.phys.msu.su/conf2003.htm
• http://acoustics.phys.msu.su/links.htm

; # Date 1327437472 -14400 # Node ID 841c47a94c9e90a8d6338a5da802846c977a5f0f # Parent 0dec37632d10c7166eab8a34b5e716079f58d415 blocks3d /wt: add abstract block (rus and eng) diff -r 0dec37632d10 -r 841c47a94c9e blocks3d /wt/ blocks3d -wt.C --- a/ blocks3d /wt/ blocks3d -wt.C Tue Jan 24 22:59:54 2012 + 0400 +++ b/ blocks3d /wt/ blocks3d -wt.C Wed Jan 25 00:37:52 2012 + 0400 @@ -33,6 +33,9 @@ new Wt::WBreak( ... Для выравнивания в целом + вычислялось среднее взвешенное число ошибок ? ...

Еще в разделе: (Показать все результаты (>6252) - kodomo.fbb.msu.ru/ )

• allpy: 841c47a94c9e
• allpy: 8b44c0e4edb5
• allpy: 292b74612a42 allpy/block.py

... 2009 . ... The International Conference on Coherent and Nonlinear Optics (ICONO) and The Lasers, Applications, and Technologies (LAT) ICONO/LAT, 18-22 June 2013, Moscow, Russia (800 участников) . ... 15th International Conference on Laser Optics ?LO-2012?, ... Amitonova L.V., Lanin A.A., Fedotov I.V., Ivashkina O.I., Zots M.A., Fedotov A.B., Anokhin K.V., Zheltikov A.M. ?Fiber-based platform interfaces for functional studies in neurophotonic? 15th International Conference on Laser Optics ?LO-2012?. ...

Еще в разделе: (Показать все результаты (>15) - photonicslab.phys.msu.ru/ )

• Collaborations

... Foundation of Physics Group University of Bari (headed by Professor Augusto Garuccio, garuccio@fisica.uniba.it), Department of Physics, Bari, Italy; . ... University of Geneva, Group of Applied Physics, Division of Optics (headed by Professor Nicolas Gisin, Nicolas.Gisin@physics.unige.ch). Joint INTAS project; . ... National University of Singapore, Faculty of Science, Department of Physics (headed by Professor C. Oh) and Laboratory of Quantum Information (headed by Professor Arthur Ekert). ...

Еще в разделе: (Показать все результаты (>115) - qi.phys.msu.ru/ )

• Publications :: Quantum Information Laboratory

... Head of the seminar: Prof. B.V. Somov, . ... The seminar considers the questions related to generation of magnetic fields in astrophysical plasmas, effect of the magnetic reconnection and particle acceleration in strong magnetic fields, the origin and propagation of cosmic rays, the flares and other non-stationary phenomena in the solar atmosphere and solar wind, Sun Earth connections and physical processes in the heliosphere. ... On the Topological Models and Topological Trigger of the Solar Flares...

Еще в разделе: (Показать все результаты (>3) - sun.sai.msu.ru/ )

... Sbornik 186 (N. 9), 19-44 (in Russian). Transl. ... Russian Math. ... Kudryavtseva, E. A. (1998): Stable invariants of conjugacy of Hamiltonian systems on two-dimensional surfaces. ... Eds. Fomenko, A.T. and Bolsinov, A.V. (Moscow: Factorial), 147-202 (in Russian). ... Math. ... Kudryavtseva, E. A. (1999): Realization of smooth functions on surfaces as height functions. ... Bogatyi, S.A., Kudryavtseva, E.A., and Zieschang, H. (2004): On coincidence points of mappings of the torus into a surface. ...

Еще в разделе: (Показать все результаты (>48) - dfgm.math.msu.su/ )

• Кудрявцева Е.А. / Кафедра Дифференциальной геометрии и приложений /
• Фоменко А.Т. / Кафедра Дифференциальной геометрии и приложений /
• Titles of talks

... Keywords: boundary-layer depth, stable stratification, Ekman layer. ... Experimental data (23) Data sets used in this paper for empirical validation of the proposed SBL depth formulation are taken from three measurement sites ( Figure 1), namely, (i) Cabauw measurement station (Nieuwstadt, 1984; Van Ulden and Wieringa, 1996), (ii) BASIS (Baltic Air-Sea-Ice Study) field experiment (Launiainen, 1999), and (iii) ETH-Greenland expedition in summer 1991 (Ohmura et al., 1992). (i) Cabauw ...

Еще в разделе: (Показать все результаты (>8) - geophys.srcc.msu.ru/ )

... Вт Фев 10 15:18:12 MSK 2009 . Следующее сообщение: PARALLEL.RU - Новости, специальный выпуск [17/02/2009] . ... Выпуск 259 . 10 февраля 2009 г. ------------- ЧТО НОВОГО? http :// parallel.ru /about/whatsnew.html + Выложена страница Основная схема быстрого преобразования Фурье . http ://fpga.parallel.ru/fft + В разделе, посвященном компьютерам с реконфигурируемой архитектурой на основе ПЛИС выложены новые статьи на странице Публикации по проекту . http ://fpga.parallel.ru/ ...

Еще в разделе: (Показать все результаты (>80) - mail.parallel.ru/ )

• PARALLEL.RU - Новости, выпуск #269 [11/08/2009]
• PARALLEL.RU - Новости, выпуск #264 [28/04/2009]
• PARALLEL.RU - Новости, выпуск #268 [07/07/2009]

Conference . ... 3rd Announcement . 2nd Announcement . ... The 2006 autumn IVOA Interoperability Meeting and Small Project Meeting will be held in Moscow, Russia, from September 18-22. The venue for the meeting are Institute of Astronomy, Sternberg Astronomical Institute and Headquarter of the Russian Academy of Sciences. ... Working Groups: VOTable, UCDs, Registry, Data Models, Data Access Layer, VO Query Language, Grid and Web Services, and VOEvent. Interest Groups: Applications, Theory. ...

Еще в разделе: (Показать все результаты (>4) - www.agora.guru.ru/ )

• Тесные двойные звезды в современной астрофизике

MOSCOW STATE UNIVERSITY The Scientific Society of students of the Law Faculty January 25, 2014 1- The flyer of the Unit `Jurisprudence' of International scientific conference "Lomonosov - 2014" 1. ... The organizers of the Unit are the law faculty of Moscow State University and the Scientific Society of students of the law faculty. ... Administrative law 2. ... The Organizing Committee: Presiding Officer ­ Kozlova Natalya Vladimirovna (Deputy Dean of Law Faculty on study, Doctor in Law, Professor). ...