XWare Поиск по информационным ресурсам МГУ English Russian
       
       Точная форма слов   О проекте   Сайты   Помощь
Поиск по:npidb.belozersky.msu.ru   - Поискать по всем серверам
На этой странице приведены все страницы сервера npidb.belozersky.msu.ru ,которые мы индексируем. Показаны документы 301 - 320 из 59120.

В начало ] Пред. | 12 | 13 | 14 | 15 | 16 | 17 | 18 | 19 | 20 | 21 | След.В конец ]

Упорядочить по: URL  |  дате изменения
301. NPIDB: Best resolution sample
... Pfam families . Best resolution sample . Best resolution Pfam family representatives bound with nucleic acid . ... Domain . ... dna . ... rna . ... Arenavirus nucleocapsid protein . ... Mitochondrial ribosomal death-associated protein 3 . ... DNA polymerase family B, exonuclease domain . ... E2F/DP family winged-helix DNA-binding domain . ... Ribosomal protein L11, RNA binding domain . ... Ribosomal Proteins L2, RNA binding domain . ... Histone RNA hairpin-binding protein RNA-binding domain . ...
[ Сохраненная копия ]  Ссылки http://npidb.belozersky.msu.ru/pfambest/pfam.html -- 854.7 Кб -- 09.04.2016
Похожие документы

302. NPIDB: 5DPK structure
... 5DPK structure . Page of complex: 5DPK . Home Browse Download Help About Us . ... PDB ID . ... MUTY ADENINE GLYCOSYLASE BOUND TO A TRANSITION STATE ANALOG (1N) PAIRED WITH D(8-OXOG) IN DUPLEXED DNA TO 2.2 A . ... View in . ... Protein chains: . DNA chains: . ... 5dpk.pdb1.pdb . ... Pfam domains . ... Download file with secondary structure created by Stride . 5dpk.pdb1.pdb: [ download sequences in FASTA format ] . ... Click "SHOW" for view sequence . ... NPIDB team 2003 - 2016 . ...
[ Сохраненная копия ]  Ссылки http://npidb.belozersky.msu.ru/complex/clist.html -- 33.2 Кб -- 09.04.2016
Похожие документы

303. Index of /data
... 2008-06-05 18:33 . ... 2011-04-27 14:10 . ... 2009-01-14 15:41 . ... 2013-01-09 13:38 . ... 2010-12-28 14:23 . ... Apache/2.4.10 (Debian) Server at npidb.belozersky.msu.ru Port 80 ...
[ Сохраненная копия ]  Ссылки http://npidb.belozersky.msu.ru/data/ -- 5.0 Кб -- 09.04.2016
Похожие документы

304. NPIDB: Interaction classes
Home . Interaction classes . Classes of protein-DNA interaction of SCOP families . Home Browse Download Help About Us . ... Pfam families . SCOP families . ... Interaction modes . ... Mj = major groove . Mn = minor groove . ... Interaction class . Number of families . Number of structures . Number of domains . ... 121 . ... 127 . ... NPIDB team 2003 - 2016 . ...
[ Сохраненная копия ]  Ссылки http://npidb.belozersky.msu.ru/contacttypesnew.html -- 20.8 Кб -- 09.04.2016
Похожие документы

305. NPIDB: Interaction classes
... Interaction classes . ... List of Contact Types: . ... Contact with Major Groove of DNA by helices, loops and Minor Groove by any element(s) . ... Contact with Major Groove of DNA by strands, loops and Minor Groove by any element(s) . ... Contact with Major Groove of DNA by loops and Minor Groove by any element(s) . ... Contact with Major Groove of DNA by any element(s) and Minor Groove by helices, loops . ... Contact with Major Groove of DNA by any element(s) and Minor Groove by loops . ...
[ Сохраненная копия ]  Ссылки http://npidb.belozersky.msu.ru/contacttypes.html -- 20.2 Кб -- 09.04.2016
Похожие документы

306. NPIDB: Services
. # . Home . Services . Services for analysing DNA/RNA-protein complexes . Home Browse Download Help About Us . List of complexes . Pfam families . SCOP families . Interaction classes . Interaction modes . GO terms . Under construction . NPIDB team 2003 - 2016 . text .
[ Сохраненная копия ]  Ссылки http://npidb.belozersky.msu.ru/services.html -- 11.0 Кб -- 09.04.2016
Похожие документы

307. NPIDB: Download
... Download . ... List of complexes . Pfam families . SCOP families . ... Download lists of data: . ... List of SCOP domains: . List of Pfam domains: . ... Pfam domains: . SCOP domains: . Download sets of representatives in PDB format: . Best representatives of Pfam domains: . Best representatives of SCOP domains: . Download calculated data: . Lists of Hbonds (txt, xml) . ... All collection is available at http://npidb.belozersky.msu.ru/data/pdb_new/ . ...
[ Сохраненная копия ]  Ссылки http://npidb.belozersky.msu.ru/download.html -- 16.7 Кб -- 09.04.2016
Похожие документы

308. NPIDB: About Us
... List of complexes . ... NPIDB, Nucleic acid ? Protein Interaction DataBase provides an access to structured and organized information about all available structures of DNA ? ... Since 2003, the database is available online. ... NPIDB: nucleic acid?protein interaction database . ... An updated version of NPIDB includes new classifications of DNA-protein complexes and their families . ... Sergey Vasilyev (the main developer of the first version of the database) . ... 03-04-48476 (2003 2005) . ...
[ Сохраненная копия ]  Ссылки http://npidb.belozersky.msu.ru/about.html -- 13.3 Кб -- 09.04.2016
Похожие документы

309. NPIDB: List of complexes
... List of complexes . List of structures of RNA-protein and DNA-protein complexes . ... Experimental method: all X-RAY DIFFRACTION SOLUTION NMR ELECTRON MICROSCOPY FIBER DIFFRACTION SOLUTION NMR; THEORETICAL MODEL SOLUTION NMR; SOLUTION SCATTERING . Kind: all rna dna hybrid . ... HYDROLASE/DNA . X-RAY DIFFRACTION . ... dna . ... RNA BINDING PROTEIN/RNA . ... rna . ... HYDROLASE/RNA/DNA . ... HYDROLASE/RNA . ... TRANSFERASE/RNA/DNA . ... TRANSFERASE/DNA/RNA . ... NPIDB team 2003 - 2016 . ...
[ Сохраненная копия ]  Ссылки http://npidb.belozersky.msu.ru/clist.html -- 30.7 Кб -- 09.04.2016
Похожие документы

310. NPIDB: Help
. # . Home . Help . Help page . Home Browse Download Help About Us . List of complexes . Pfam families . SCOP families . Interaction classes . Interaction modes . GO terms . Under construction . Main page . List of complexes . Page of a complex . List of Pfam families . Page of a Pfam family . Blocks-3D . List of SCOP families . Page of a SCOP family . Conserved water . Interaction classes . Services . Nucleic acid тАУ protein interaction . NPIDB team 2003 - 2016 . text .
[ Сохраненная копия ]  Ссылки http://npidb.belozersky.msu.ru/help.html -- 11.8 Кб -- 09.04.2016
Похожие документы

311. NPIDB: SCOP families
... SCOP families . ... List of Scop domains: . ... List of SCOP families detected in NPIDB entries: . ... CF: A DNA-binding domain in eukaryotic transcription factors . ... SF: TROVE domain-like . ... FA: C-terminal domain of glutamyl-tRNA synthetase (GluRS) . ... FA: 39 kda initiator binding protein, IBP39, N-terminal domain [ a.4.5.44 ] . ... SF: Methylated DNA-protein cysteine methyltransferase, C-terminal domain . ... SF: Ribosomal protein L11, C-terminal domain . ... SF: Rho N-terminal domain-like...
[ Сохраненная копия ]  Ссылки http://npidb.belozersky.msu.ru/scop.html -- 491.8 Кб -- 09.04.2016
Похожие документы

312. NPIDB: Pfam families
... Pfam families . ... List of Pfam domains: . ... List of Pfam families detected in NPIDB entries: . ... RNA binding protein B2 . ... Bunyavirus RNA dependent RNA polymerase . ... Mitochondrial ribosomal death-associated protein 3 . ... DNA polymerase family A . ... DNA polymerase family B, exonuclease domain . ... E2F/DP family winged-helix DNA-binding domain . ... Nucleolar RNA-binding protein, Nop10p family . ... RNA polymerase recycling family C-terminal . ... Ribosomal protein L1p/L10e family . ...
[ Сохраненная копия ]  Ссылки http://npidb.belozersky.msu.ru/pfam.html -- 573.0 Кб -- 09.04.2016
Похожие документы

313. NPIDB: Home
Home . Database of structures of nucleic acid - protein complexes . ... List of complexes . Pfam families . SCOP families . Interaction classes . ... NPIDB . ... Information on SCOP and Pfam domains detected in protein chains is presented. ... Each family has its own web page with the list of entries that include domains of the family. ... List of SCOP domains occurred in DNA-protein and RNA-protein complexes is organized in tree-like form, according to the SCOP classification. ...
[ Сохраненная копия ]  Ссылки http://npidb.belozersky.msu.ru/ -- 15.4 Кб -- 09.04.2016
Похожие документы

314. http://npidb.belozersky.msu.ru/data/results/10ba53c1db120079c7f1ba8b6913fc58.blast.query.fas
>query 1sp1
[ Сохраненная копия ]  Ссылки http://npidb.belozersky.msu.ru/data/results/10ba53c1db120079c7f1ba8b6913fc58.blast.query.fas -- 1.0 Кб -- 21.03.2016
Похожие документы

315. http://npidb.belozersky.msu.ru/data/results/89693bc8377464558e59df926e4e5111.blast.query.fas
>query RKD1
[ Сохраненная копия ]  Ссылки http://npidb.belozersky.msu.ru/data/results/89693bc8377464558e59df926e4e5111.blast.query.fas -- 1.0 Кб -- 21.03.2016
Похожие документы

316. http://npidb.belozersky.msu.ru/data/results/644d16fa3e26c912bd19977faa6ad7e1.blast.query.fas
query gaattcgggatcagggcaagcattgtggagcggttccttatgccaggctgccatgtgagatgatccaagaccaaaacaag gccctagactgcagtaaaacccagaactcaagtagggcagaaggtggaaggctcatatggatagaaggcccaaagtataa gacagatggtttgagacttgagacccgaggactaagatggaaagcccatgttccaagatagatagaagcctcaggcctga aaccaacaaaagcctcaagagccaagaaaacagagggtggcctgaattggaccgaaggcctgagttggatggaagtctca aggcttgagttagaagtcttaagacctgggacaggacacatggaaggcctaagaactgagacttgtgacacaaggccaac ...
[ Сохраненная копия ]  Ссылки http://npidb.belozersky.msu.ru/data/results/644d16fa3e26c912bd19977faa6ad7e1.blast.query.fas -- 2.6 Кб -- 28.02.2016
Похожие документы

317. http://npidb.belozersky.msu.ru/data/results/83254e0a97ea7663114bfe6bb4eda58c.blast.query.fas
>query hotair
[ Сохраненная копия ]  Ссылки http://npidb.belozersky.msu.ru/data/results/83254e0a97ea7663114bfe6bb4eda58c.blast.query.fas -- 1.0 Кб -- 17.02.2016
Похожие документы

318. http://npidb.belozersky.msu.ru/data/results/3e370d41b91ce6b41cdc5a436d05509a.blast.query.fas
>query EGFR
[ Сохраненная копия ]  Ссылки http://npidb.belozersky.msu.ru/data/results/3e370d41b91ce6b41cdc5a436d05509a.blast.query.fas -- 1.0 Кб -- 08.02.2016
Похожие документы

319. http://npidb.belozersky.msu.ru/data/results/c6c508043947ae9ffbdda414cf54137e.blast.query.fas
>query Nucleolin
[ Сохраненная копия ]  Ссылки http://npidb.belozersky.msu.ru/data/results/c6c508043947ae9ffbdda414cf54137e.blast.query.fas -- 1.0 Кб -- 06.02.2016
Похожие документы

320. http://npidb.belozersky.msu.ru/data/results/c6c508043947ae9ffbdda414cf54137e.fz.txt
Program: fuzznuc # Rundate: Sat 6 Feb 2016 08:57:39 # Commandline: fuzznuc # -sequence / data / npidb / pdb / pdb_new /DB/NucleicDB.fas # - pattern NTcleolin # -pmismatch 0 # -outfile / data / npidb / pdb / pdb_new /../ results / c6c508043947ae9ffbdda414cf54137e.fz.txt # Report_format: seqtable # Report_file: / data / npidb / pdb / pdb_new /../ results / ...
[ Сохраненная копия ]  Ссылки http://npidb.belozersky.msu.ru/data/results/c6c508043947ae9ffbdda414cf54137e.fz.txt -- 1.8 Кб -- 06.02.2016
Похожие документы

В начало ] Пред. | 12 | 13 | 14 | 15 | 16 | 17 | 18 | 19 | 20 | 21 | След.В конец ]

Rambler's Top100 RFBR Яндекс цитирования