Astronomy Picture of the Day . Earth at Night . ... 22.08.2004 . ... Credit: C. Mayhew R. Simmon ( NASA / GSFC ), NOAA / NGDC , DMSP Digital Archive Explanation: This is what the Earth looks like at night. Can you find your favorite country or city ? ... Human-made lights highlight particularly developed or populated areas of the Earth's surface, including the seaboards of Europe , the eastern United States , and Japan . ... August . ... Publications with keywords: Earth - light pollution . ...

Еще в разделе: (Показать все результаты (>75264) - www.astronet.ru/ )

• APOD: 2006 October 1- Earth at Night

... 2014 February 3 . Lunar Time Lapse Panorama including Yutu Rover . ... Explanation: Where has the Yutu rover been on the Moon? ... Because it uses solar power , the mechanical Jade Rabbit goes into sleep mode to endure the two-week long lunar night. Pictured above is a digitally created time-lapse composite panorama showing the region surrounding the Chang'e 3 lander , capturing the desk-sized rover in three positions. ... Organize Your Universe: Free APOD 2014 Calendar in PDF format . ...

Еще в разделе: (Показать все результаты (>10057) - www.sai.msu.su/ )

• APOD: 2005 June 14 - Gliese 876 System Includes Large Terrestrial Planet
• APOD: December 30, 1996 - X-Ray Earth
• APOD Index - Solar System: Venus

This example shows how to make, store to file, and read a picture as a set of drawing commands. ... This example ** program may be used, distributed and modified without limitation. ** *****************************************************************************/ # include ctype.h # include qapplication.h # include qpainter.h # include qpicture.h # include qpixmap.h # include qwidget.h # include qmessagebox.h # include qfile.h void paintCar( QPainter *p ) // ...

Еще в разделе: (Показать все результаты (>982) - rtm-cs.sinp.msu.ru/ )

• Qt Toolkit - QPicture Class
• Qt Tutorial - Chapter 1
• Qt Toolkit - qpicture.h include file

... You can create six sizes of headings - <h1>...<h6> in HTML - by typing, from the beginning of a line, three dashes (-), from one to six plus signs (+), a space, and your heading text. ... The easiest way of including images is to attach a GIF, JPG or PNG file to a topic and then to include it with text %ATTACHURL%/myImage.gif . ... The quickest way is to use the <font color="colorCode"> and </font> tags - they're HTML tags that work in any browser, (although they've been phased in the latest version...

Еще в разделе: (Показать все результаты (>39253) - dualopt1.cmm.msu.ru/ )

• %TOPICTITLE% (7 vs. 8) - TWiki
• %TOPICTITLE% (8 vs. 9) - TWiki
• %TOPICTITLE% (1 vs. 2) - TWiki

... 2000 October 23 . Dwarf Elliptical Galaxy NGC 205 in the Local Group . ... It is part of a gathering of about 25 galaxies known as the Local Group . ... Pictured on the lower left is one of the many dwarf ellipticals : NGC 205 . ... The above image shows NGC 205 to be unusual for an elliptical galaxy in that it contains at least two dust clouds (at 1 and 4 o'clock - they are visible but hard to spot) and signs of recent star formation . ... About APOD | ...

Еще в разделе: (Показать все результаты (>132) - www.arcetri.astro.it/ )

• APOD: 2000 February 28 - The Sombrero Galaxy from VLT
• APOD: November 11, 1997 - The Annotated Galactic Center
• APOD: 2001 January 21 - Resolving Mira

... Кафедра общей экологии Биологического факультета МГУ им. М.В. Ломоносова и . Институт проблем экологии и эволюции им. А.Н. Северцова РАН . Активные темы Список участников Поиск по форуму Помощь . ... Экологический Форум - Фундаментальная Экология : Предложения и замечания по сайту . Тема: includes a more compact head . ... Переход на форум -- Выберите форум -- О сайте "Фундаментальная экология" - Предложения и замечания по сайту Научные семинары - Научные семинары . ...

Еще в разделе: (Показать все результаты (>7972) - www.sevin.ru/ )

• Экологический Форум - Фундаментальная Экология: I may have some pictures to...
• Экологический Форум - Фундаментальная Экология: consumers. Yves Mall including:
• Экологический Форум - Фундаментальная Экология: Programs include free Academics

... Main page . ... Author . FemtoScan Online page two . ... The program works under Windows 95 and Windows NT, multiple document interface, wide set of mathematical and user functions. Designed for Nanoscope II, Nanoscope III & Femtoscan files, including f(z) files. ... build sections, histograms, measure height, angles and curves, use common and specific mathematical functions for image processing . use custom palettes, change color mapping, change scaling factor, save picture as bitmap . ...

Еще в разделе: (Показать все результаты (>148) - www.spm.genebee.msu.ru/ )

PHP Manual . ... The include_once() statement includes and evaluates the specified file during the execution of the script. This is a behavior similar to the include() statement, with the only difference being that if the code from a file has already been included, it will not be included again. ... For more examples on using require_once() and include_once() , look at the PEAR code included in the latest PHP source code distributions. Note: include_once() was added in PHP 4.0.1pl2 . ...

Еще в разделе: (Показать все результаты (>427) - oit.cmc.msu.ru/ )

• include
• get_included_files
• Including Output in phpinfo

... My first name is pronounced with a long "a" and a : short "u" (so it sounds like "famous") : Description : 10 levels for DOOMII! These are high quality : levels, not just a bunch of boxy rooms with : mismatched and unaligned textures. The levels : include new sounds, new graphics, and all - new : music! The final level puts you up against the most : hideous monster you've ever seen: a hundred foot : high picture of my face! ... Let me know what you think of my level! ...

Еще в разделе: (Показать все результаты (>6603) - crydee.sai.msu.ru/ )

• http://crydee.sai.msu.ru/ftproot/pub/rec/games/idgames/levels/doom2/d-f/doomy.txt
• http://crydee.sai.msu.ru/ftproot/pub/rec/games/idgames/levels/doom/0-9/22ventry.txt
• http://crydee.sai.msu.ru/ftproot/pub/MESA-models/M6_Z002/inlist_project

Silk icon set 1.3 _________________________________________ Mark James http://www.famfamfam.com/lab/icons/silk/ _________________________________________ This work is licensed under a Creative Commons Attribution 2.5 License. [ http://creativecommons.org/licenses/by/2.5/ ] This means you may use it for any purpose, and make any changes you like. ... Send me an email (including a link or picture if available) to mjames@gmail.com Any other questions about this icon set please contact mjames@gmail.com ...

Еще в разделе: (Показать все результаты (>6158) - wiki.cmc.msu.ru/ )

• VarINCLUDE < System < Foswiki

... Другие названия журнала: Advances in Space Research (includes Cospar Information Bulletin , Advances in Space Research(includes Cospar Information Bulletin) . ... Lipunov V. в журнале Advances in Space Research (includes Cospar Information Bulletin) . ... Sajid M. , Chechenin N.G. , Torres F.S. , Khan E.U. , Agha S. в журнале Advances in Space Research (includes Cospar Information Bulletin) , том 56, с. 314-324 DOI . ...

Еще в разделе: (Показать все результаты (>2919) - istina.msu.ru/ )

• Virchows Archiv. B, Cell pathology including molecular pathology - журнал |
• Korablev O. - сотрудник | ИСТИНА - Интеллектуальная Система Тематического

... Alignment Sequence . Include picture . No Picture Only Structure Structure and BP numbers Structure and Stem Energy Full Picture . Sequence name . Alignment OR sequence (without name). The usage of Alignment is strongly recommended. Alignment example: . ... ANMF CGCGGGGTAGAGCAGCCTGGTAGCTCGTCGGGCTCATA AQTRNF GCC-AGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAA BGTRF GCC-AGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAT ANMF ATCCTCTCCCCGCC---- AQTRNF ATCCGCCTCCCGGCACCA BGTRF ATCCGCCTCCCGGCACCA . ...

Еще в разделе: (Показать все результаты (>195) - www.genebee.msu.ru/ )

• TreeTop - Phylogenetic Tree prediction
• AliGraf - GeneBee Graphical Alignment Help

... HelpOnMacros/Include . ... Include(pagename, heading, level, from="regex", to="regex", sort=ascending|descending, items=n, skipitems=n, titlesonly, editlink)>> . ... Text for the generated heading which will link to the included page (optional). level . ... Include the text of page FooBar in the current paragraph: <<Include(FooBar)>> . ... Sort the page list in descending order: <<Include(^FooBar/.*, , sort=descending)>> . Include a maximum of three pages: <<Include(^FooBar/.*, , items=3)>> . ...

Еще в разделе: (Показать все результаты (>515) - uneex.lorien.cs.msu.su/ )

• MirrorEn ? ALT Linux Wiki
• HelpOnParsers/ReStructuredText - UNИX
• License agreement

... HelpOnMacros/Include . ... Include(pagename, heading, level, from="regex", to="regex", sort=ascending|descending, items=n, skipitems=n, titlesonly, editlink)>> . ... Text for the generated heading which will link to the included page (optional). level . ... Include the text of page FooBar in the current paragraph: <<Include(FooBar)>> . ... Sort the page list in descending order: <<Include(^FooBar/.*, , sort=descending)>> . Include a maximum of three pages: <<Include(^FooBar/.*, , items=3)>> . ...

Еще в разделе: (Показать все результаты (>184) - uneex.mithril.cs.msu.su/ )

• HelpOnParsers/ReStructuredText - UNИX

Электронная библиотека Попечительского совета . ... Drewes F. - Grammatical Picture Generation . ... Название: Grammatical Picture Generation . Автор: Drewes F. Аннотация: . This book introduces the reader to the grammatical theory of picture generation, focussing on issues that are of particular interest for computer scientists. ... Электронная библиотека попечительского совета мехмата МГУ , 2004-2016 . ...

Еще в разделе: (Показать все результаты (>20064) - lib.mexmat.ru/ )

• Picture Chord Encyclopedia :: Электронная библиотека попечительского совета
• Lamb H. - Statics. Including Hydrostatics and the Elements of the Theory of
• Long B. - Getting Started with Camera Raw: How to make better pictures using

... What Is Included In The Standard? Up: Introduction to MPI Next: What Is Not Included In The Standard? Previous: What Platforms Are Targets For Implementation? The standard includes: . Point-to-point communication . ... Communication contexts . ... Return to MPI Standard Index . Return to MPI home page . ... Центры . ...

Еще в разделе: (Показать все результаты (>619) - www.parallel.ru/ )

• What Is Not Included In The Standard? | PARALLEL.RU -
• Installing
  <tt> mpich
  </tt> for Others to Use | PARALLEL.RU -
• MPI_Get_processor_name | PARALLEL.RU - Информационно-аналитический центр по

... Manuscripts submitted to the journal should be divided into the following sections: Title page, Abstract (in Russian and English), Key words (in Russian and English), main manuscript text, list of references, tables, figures and figure captions. ... Full size of the article includes list of references, tables and figures. ... Rich text format (*.rtf) . ... References are given in the text in square brackets; full references are given at the end of the manuscript in the section List of references. ...

Еще в разделе: (Показать все результаты (>25) - www.anthropos.msu.ru/ )

Calendars Order images | ... Calendars . ... We collect our best pictures for calendars sets. ... Volcanoes of Kamchatka . Best shots of Kamchatka's volcanoes. ... Volcanoes at winter. ... Kamchatka . Fastination landscapes of famous kamchatka's Gaiser's Valley. ... Kamchatka: volcanoes, sea and ice . 13 best shots of different Kamchatka's landscapes - sea cost, icebergs, frosen sea, storming sea, volcanoes. ... Orders can be made via e-mail, or post. ... EcoPhoto Imagery . ...

Еще в разделе: (Показать все результаты (>259) - www.fadr.msu.ru/ )

• "EcoPhoto" - Order photo - CD
• Abstracts
• REPORT ON INTERNATIONAL SOIL SCIENCE CONGRESS (Montpellier, France, August...

CompHEP uses the Axodraw package by J.A.M. Vermaseren [ Vermaseren-1994 ] to write diagrams and plots in L A T E X format. ... The Axodraw syntax is very easy and you can alter the CompHEP output to get some local correction in picture if any. The user can also change line width, scale of picture, and size of characters. ... For example, { \small % letter size control \SetWidth{0.7} % line width control \SetScale{1.0} % line scale control \unitlength=1.0 pt % text position control .. ...

Еще в разделе: (Показать все результаты (>2081) - theory.sinp.msu.ru/ )

• Structure of LanHEP input file
• Pictures
• [RU-NGI] openssl w/ vulnerability and new certs

Text can be included in the shell script by using a here document, a special form of input redirection. The << symbol is used to indicate that text should be read up to a given mark. For example: #!/bin/sh # this script outputs the given text before it runs cat << EOF This shellscript is currently under development, please report any problems to Danny (danny@cornflake.ed) EOF exec /usr/local/test/bin/test_version . ...

Еще в разделе: (Показать все результаты (>225) - comet.sai.msu.ru/ )

• Washington 2002 + few El Paso pictures
• Pictures of Crimea
• Command substitution