... Each day a different image or photograph of our fascinating universe is featured, along with a brief explanation written by a professional astronomer. 2000 September 26 . Approaching Jupiter . Credit: Voyager 1 Spacecraft Team , JPL , NASA . Explanation: In 1979 the Voyager 1 spacecraft compiled this view as it approached the gas giant Jupiter . ... Since Jupiter takes about 10 hours to rotate, this short sequence actually covers several days. ... About APOD | ... NASA Technical Rep.: ...

Еще в разделе: (Показать все результаты (>2768) - www.sai.msu.su/ )

• APOD: 2000 September 27 - Yepun
• APOD: 2005 September 13 - A Quadruple Sky Over Great Salt Lake
• APOD: 2000 September 4 - Aurora Persei

... 2000 September 21 . XZ Tauri System Ejects Gas Bubble . ... Explanation: Why is the binary star system XZ Tauri emitting a hot bubble of expanding gas? ... The XZ Tauri star system is known to reside in the Taurus star forming region located about 500 light-years away. ... The bubble has been expanding over the past thirty years and now extends to nearly fifteen times the binary separation. Tomorrow's picture: Star Cluster . ... About APOD | ...

Еще в разделе: (Показать все результаты (>132) - www.arcetri.astro.it/ )

• APOD: September 25, 1997 - T Pyxidis: Recurrent Nova
• APOD: September 5, 1998 - The Pulsar Powered Crab
• APOD: September 22, 1998 - M61: Virgo Spiral Galaxy

... 1.09.2007 . ... Credit: Yuichi Takasaka Explanation: Recorded on August 28th , this serene total lunar eclipse sequence looks southwest down Kalamalka Lake toward the lights of Coldstream , British Columbia. An exposure every 4 minutes captured the Moon's position and eclipse phase, until the Moon set behind the town lights and a hill on the horizon. In fact, the sequence effectively measures the duration of the total phase of the eclipse . ... Publications with keywords: lunar eclipse . ...

Еще в разделе: (Показать все результаты (>74273) - www.astronet.ru/ )

• Total Lunar Eclipse over Waterton Lake
• APOD: 2006 September 28- RCW 86: Historical Supernova Remnant
• Астронет > APOD: 2006 September 28- RCW 86: Historical Supernova Remnant

... In the small-x approximation: u u = x p (neglecting also the quark masses) p A.V . Lipatov QFTHEP 2010 , Golitsyno , Russia , September 10, 2010 Calculations III KMR unintegrated PDFs M.A. Kimber, A.D. Martin, M.G. Ryskin, PRD 63, 114027 (2001) 2 f q x , k 2 , 2 ~T q k 2 , 2 [ Pqq вq x , k T P ... Kutak, DIS'08 sea quark density is approximated by the last gluon splitting, i.e. f s q 2 x , k 2 , 2 ~ P qg в f g x , k T , 2 T A.V ...

Еще в разделе: (Показать все результаты (>187) - qfthep.sinp.msu.ru/ )

• September 29, 2011
• September 14, 2010
• September 30, 2011

... Previous message: [Computer_algebra] Meeting on September 17 . ... Dear Colleagues, In technical reason the beginning of the seminar on September 17 is shifted to 16-20. ... In the talk, we discuss the following variants of the least squares problem: 1. ... АБСТРАКТ Пусть $Ax = b$ --- система линейных уpавнений с выpожденной или пpямоугольной матpицей $A.$ В докладе pечь пойдет о pешении такой системы в смысле наименьших квадpатов, т.е. так, чтобы минимизиpовать евклидову длину невязки $b - Ax.$ ...

Еще в разделе: (Показать все результаты (>872) - theory.sinp.msu.ru/ )

• [Computer_algebra] Meeting on September 17
• Gallery :: EGEE 2008, 22-26 September, Stambul, Turkey :: dsc_2215
• QFTHEP'97 Workshop

... Academic Programmes . ... NEW Dates Price . ... 4 weeks minimum . ... TUITION FEES . ... Full-Time Tuition - 2 6 academic hours per week : . ... Part-Time Tuition - 18 academic hours per week : . ... If paid in several installments, course fees are calculated at the rate of US $ 150 per week for full-time tuition and US $ 120 per week for part-time tuition. ... 1 Full-Time Tuition (24 academic hours per week) US $ 1 95 per week . ... Part-Time Tuition (20 academic hours per week) US $ 1 70 per week ...

Еще в разделе: (Показать все результаты (>20) - www.cie.ru/ )

• Tuition Fees :: Admissions :: CIE
• Frais de scolarit? :: Condition d??tudes :: CEI
• Study Periods :: Admissions :: CIE

Tuesday, September 28th, 2010 . 14-17 сентября 2010 года прошла международная конференция WEGENER (http://www NULL .koeri NULL .boun NULL .edu NULL .tr/jeodezi/wegener2010/) (Bogazici University, Istanbul / TURKEY), в которой мы приняли участие и сделали два доклада: . ... You are currently browsing the Лаборатория лазерной интерферометрии blog archives for September, 2010. ... Публикации за 2011 . Публикации за 2012 . ... Лаборатория лазерной интерферометрии is proudly powered by WordPress . ...

Еще в разделе: (Показать все результаты (>38) - geo.sai.msu.ru/ )

• September 2013 Лаборатория лазерной интерферометрии

... Large . ... Normal . ... Thumbnails . ... Enter: Large | ... Contents with thumbnails: Large | ... Florence streets . ... Rome. ... Sunday, 12 September. ... Monday, 13 September. ... Tuesday, 14 September. ... Wednesday, 15 September. ... Thuesday, 16 September. ... Friday, 17 September. ... Saturday, 18 September. ... There's also index of the complete set of photos with thumbnails. ... return to photo album contents | ...

Еще в разделе: (Показать все результаты (>2482) - crydee.sai.msu.ru/ )

• Friday, 17 September. San Croce, Duomo
• Saturday, 18 September. Rome
• Tuesday, 14 September. Across the Arno

... Faculty of Physics . M.V.Lomonosov Moscow State University . ... Students . ... 29.08.2003 . September 1st, 2003, is the Day of the first-year students of Moscow State University. For the freshmen at the Faculty of Physics, the dean of Physics, Prof. V.I.Trukhin, will deliver the first lecture, introducing the Faculty of Physics. ... Prof. Victor Sadovnichii will deliver a public lecture for the freshmen of Moscow State (room 01, Main Bldg., ... Faculty of Physics, 2016 . ...

Еще в разделе: (Показать все результаты (>96) - phys.msu.ru/ )

• Лекция М.Ю.Кагана (Lecture of Prof. M.Yu.Kagan, 19 September, 2012)

... Главная -> Фильмы -> September Tapes . ... Фильмы . ... September Tapes . ... США 2004 . ... Dawood Zarif . Zahir Zarif . ... Sher Alai . Sher Agah . ... Sharif Omar . ... Omar Qudrat . Adam Khadjiev . ...

Еще в разделе: (Показать все результаты (>189) - kinfo.ru/ )

• September Dawn - Фильмы - Kinfo.ru
• Until September - Фильмы - Kinfo.ru
• September - Фильмы - Kinfo.ru

. Main page . Photos . My brother . My brother . My brother . My brother . Previous page . 1 2 3 4 5 6 7 8 . Next page . Not paginated version of this web-page . Копосов Сергей , 2003-2007 . Koposov Sergey , 2007

Еще в разделе: (Показать все результаты (>242) - lnfm1.sai.msu.ru/ )

• Photos from the ADASS conference and the trip to Spain and Portugal
• MFS, HSFA-2 animation

Central Idaho and Montana, September 1-4, 2006 . ... img_4215 . img_4217 . img_4218 . ... This thumbnail page was generated by XnView ...

Еще в разделе: (Показать все результаты (>484) - herba.msu.ru/ )

• Palouse and McCall, September 28-30, 2006
• What's new?

... This is the introduction to the seventeenth issue of the Fulbright Academy of Science & Technology's electronic newsletter. ... This month, instead of sending the full newsletter, we are just sending a summary, with a link to the full text on our website. ... A new investment tool - a stock index for alternative energy, created by an Academy member . News from other members and affiliated organizations, including some grant opportunities . ... Fulbright Academy of Science & Technology . ...

Еще в разделе: (Показать все результаты (>79) - www.prof.msu.ru/ )

• Содержание
• Central Eurasian Studies Society Sixth Annual Conference (2005)

... Pyrococcus furios (14506) [f] 149 41.9 3.6e-05 AE010241 AE009950 |AE010241| ... Pyrococcus furiosus DSM 3 (14506 nt) initn: 141 init1: 116 opt : 149 Z-score: 163.3 bits : 41.9 E(): 3.6e-05 banded Smith-Waterman score: 149; 78.8% identity (78.8% similar) in 52 nt overlap (19-69:9586-9637) 10 20 30 40 U00096 TGGTGCTGATACCCAGAGTCGAACTGGGGACCTCACCCTTACCAAGGG : :::: ::::::: : ::::::::: : AE0102 TTATTAAAAACATGGAGCCCCGGCCGGGCTTTGAACCCGGGACCTGCCGCTTACCAAGCG 9560 9570 9580 9590 9600 9610 50 60...

Еще в разделе: (Показать все результаты (>3394) - kodomo.cmm.msu.ru/ )

• http://kodomo.cmm.msu.ru/~kropa8848/term4/practice9/al_tm.msf
• http://kodomo.cmm.msu.ru/~sandra/Term4/settings.txt
• Conservative Amino Acid Residues

. September 16 . G . Page: 1 2 . [ Prev ] [ Next ]

Еще в разделе: (Показать все результаты (>128) - mgumus.chem.msu.ru/ )

• September 18
• September 14
• September 17

Электронная библиотека Попечительского совета . ... Science (Vol. 305, No. 5690, September 2004) . ... Название: Science (Vol. ... Тип: Журнал Science . ... Год издания: 2004 . ... Электронная библиотека попечительского совета мехмата МГУ , 2004-2016 . ...

Еще в разделе: (Показать все результаты (>8003) - lib.mexmat.ru/ )

• Scientific American (September, 2001) :: Электронная библиотека попечительского
• Scientific American (September, 2000) :: Электронная библиотека попечительского
• PC magazine (September 20, 2005) :: Электронная библиотека попечительского

. Victor I. Mokeev. N* Studies in Meson Electroproductionwith CLAS V.I. Mokeev. The models for evaluation of ? v NN* electrocouplings from the N?, N?? electroproduction data and their extension for photon virtualities up to 12 GeV 2 .

Еще в разделе: (Показать все результаты (>142) - nuclphys.sinp.msu.ru/ )

• Unveiling of the bust in memory of N.N.Bogolliubov at the Conference Hall of

19. http://mirror.msu.net/pub/rfc-editor/internet-drafts/draft-zhang-banana-tcp-in-bonding-tunnels-00.txt

20. http://classic.chem.msu.su/gran/gamess/gcmcscf.pdf