... The primary monoclonal antibodies specific to the N-terminal domain of human ER protein (clone 14C8, Abcam) and the secondary FITC-conjugated antibodies (F2772, Sigma) were used in the investigation. ... Human breast adenocarcinoma cell line MCF-7 and the range of the primary antibody concentrations 0.06, 1.2 and 2.5 µg/ml is recommended for the regular antibody activity control in clinical using. Moscow University Chemistry Bulletin . 2011, Vol. ... 4, P. 305 . ...

Еще в разделе: (Показать все результаты (>2215) - chem.msu.ru/ )

Brain Research Group >> Research >> Change-point analysis ... << previous next >> . ... It is necessary to note that a change-point detection method which we applied to a real EEG signal was developed on the basis of the piecewise stationarity model of the signal. ... The data presented in this Chapter demonstrate that the effective detection of the change-points opens the way for a number of new methods of the analysis of complex signals such as the EEG. ...

Еще в разделе: (Показать все результаты (>59) - brain.bio.msu.ru/ )

• Other prospects of the change-point based analysis
• Analysis of change-point synchronization in multi-channel EEG

... Другие названия журнала: J SURF INVEST , J. of Surface Investigation, Springer , JOURNAL OF SURFACE INVESTIGATION - X-RAY SYNCHROTRON AND NEUTRON TECHNIQUES показать полностью.. ... Xray, Synchrotron and Neutron Techniques , Journal of Surface Investigation. ... X-Ray, Synchrotron and Neutron Techniques, издательство Gordon and Breach Science Publishers (Amsterdam, the Netherlands) , Surface Investigation: X-Ray, Synchrotron and Neutron Techniques , Surface investigations . ...

Еще в разделе: (Показать все результаты (>5558) - istina.msu.ru/ )

... Alignment Sequence . Include picture . No Picture Only Structure Structure and BP numbers Structure and Stem Energy Full Picture . Sequence name . Alignment OR sequence (without name). The usage of Alignment is strongly recommended. Alignment example: . ... ANMF CGCGGGGTAGAGCAGCCTGGTAGCTCGTCGGGCTCATA AQTRNF GCC-AGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAA BGTRF GCC-AGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAT ANMF ATCCTCTCCCCGCC---- AQTRNF ATCCGCCTCCCGGCACCA BGTRF ATCCGCCTCCCGGCACCA . ...

Еще в разделе: (Показать все результаты (>206) - www.genebee.msu.ru/ )

In our model for RNA secondary structure formation we assume that each of the candidate helices (see definition in the main text) may exist in two states. A helix can be completely zipped, or it can be completely decayed. ... The following schema is used to estimate the effective transition constants between zipped and decayed states: . ... To determine the kinetic constants, we use the transition state theory, which is often used in chemical kinetics (Figure 2). ... Transition . ...

Еще в разделе: (Показать все результаты (>7) - bioinf.fbb.msu.ru/ )

EQUIVALENT DIPOLES APPROACH TO THE ELECTRICAL FIELD VECTOR MEASUREMENTS DATA INTERPRETING Aleksandr A. Gorbunov, Igor. ... Generalizing the traditional apparent resistivity [pic] for the pole- dipole (half-Schlumberger) array, the apparent resistivity vector [pic] with components [pic] is introduced. ... Considering the layered cross-section as the embedding medium, apparent resistivity vector can be presented as [pic] - the sum of the normal and the anomalous apparent resistivity. ...

Еще в разделе: (Показать все результаты (>68) - geophys.geol.msu.ru/ )

• http://geophys.geol.msu.ru/shevnin/publ/84.pdf
• http://geophys.geol.msu.ru/STUDY/manual/ie2.doc
• http://www.geol.msu.ru/deps/geophys/inggeol.htm

... Therefore, we should aim at continuously increasing our understanding of pedogenic processes, their rates, and the ways in which they are influenced by soil forming factors, including man, in order to build a reliable basis for the correct and efficient use of the potential of the soil archive. One important step in this direction was the conference "Global Soil Change: Time-Scales and Rates of Pedogenic Processes" in May 2005 in Mexico . ...

Еще в разделе: (Показать все результаты (>97) - www.fadr.msu.ru/ )

... Straumann D. - Estimation in Conditionally Heteroscedastic Time Series Models . ... Название: Estimation in Conditionally Heteroscedastic Time Series Models . ... In his seminal 1982 paper, Robert F. Engle described a time series model with a time-varying volatility. ... This monograph concentrates on mathematical statistical problems associated with fitting conditionally heteroscedastic time series models to data. ... Электронная библиотека попечительского совета мехмата МГУ , 2004-2016 . ...

Еще в разделе: (Показать все результаты (>7710) - lib.mexmat.ru/ )

• Bishwal J.P. - Parameter Estimation in Stochastic Differential Equations ::
• Simon D. - Optimal State Estimation: Kalman, H Infinity, and Nonlinear
• Wunsch C. - Discrete Inverse and State Estimation Problems: With Geophysical

Graphite-bearing carbonatite of Guli massif. ... This carbonatite is anhimonomineral calcitic rock (sevite) with minor amounts of dolomite, phlogopite, amphibole and K-feldspar. ... Graphite (black) intergrowth with phlogopite (light-grey) in calcite (grey). ... Dolomite contain 3-4 % of calcite component. ... P-T and f(O2)-T conditions for dolomite+K-feldspar+calcite+phlogopite+graphite association estimated by thermochemical calculations with program complex BAYES (Chatterjee et al., ...

Еще в разделе: (Показать все результаты (>693) - geo.web.ru/ )

• http://geo.web.ru/~ariskin/docs/papers/d97_108.pdf
• http://geo.web.ru/conf/alkaline/2009/ZaitsevV3.htm
• Авторский сайт Владимира Мальцева - литература

... Our aim was to investigate the influence of weather conditions and prey on the leaf-trapping behaviour of insectivorous plant Drosera rotundifolia (Droseraceae) in the natural habitat. ... We propose that in natural undisturbed conditions changes of the leaf blade characteristics are casual and are augmented by the external factors such as relative air humidity, atmosphere pressure and presence of the prey on the leaf blade. ...

Еще в разделе: (Показать все результаты (>254) - herba.msu.ru/ )

... Thomson's multiple window method of spectral estimationthomson provides a very good estimate of the power spectrum by measuring the energy contained within a collection of rectangular shaped frequency intervals. ... Often, much of the fine structure of a spectral estimate is due to noise. It should be stressed that while other methods of spectral estimation (such as the Welchoppenheim method) exist, the Thomson method is particularly noteworthy for its precisely defined rectangular frequency bins. ...

Еще в разделе: (Показать все результаты (>1078) - crydee.sai.msu.ru/ )

• Recommended reading
• Hardware and Software Requirements
• Conformance: requirements and recommendations

PUZZLE . PUZZLE is an application to reconstruct phylogenetic trees from molecular sequence data by maximum likelihood. It implements a fast tree search algorithm (quartet puzzling) that allows analysis of large data sets and automatically assigns estimations of support to each internal branch. ... All model parameters including rate heterogeneity can be estimated from the data by maximum likelihood. ... None . ... SAL Home | Other Scientific Fields | Chemistry, Biology Related . ...

Еще в разделе: (Показать все результаты (>1396) - www.sai.msu.su/ )

• SAL- Other Scientific Fields - Chemistry, Biology Related - SEALS
• SAL- Other Scientific Fields - Chemistry, Biology Related - SCORE
• SAL- Computer Graphics, Images Signals - Misc - MTM

. Summary of experimental results . The light absorbing capacity of phytoplankton, estimated from Fo , and its photosynthetic activity (estimated as Fv/Fm ) are key characteristics of the primary processes of photosynthesis. We suggested a formula for calculation of the primary production of phytoplankton from these two characteristics and underwater irradiance. The probing data were used to plot vertical profiles of phytoplankton productivity in various regions of the Baltic, Norwegian, and South China

Еще в разделе: (Показать все результаты (>21) - www.biophys.msu.ru/ )

... Convergence rate estimation for finite-difference methods of solving the ill-posed Cauchy problem for second-order linear differential equations in a Banach space . ... An iterative method for solving the regularized Bingham problem . ... Parallel implementation of 2D IIR-filters using image processing distributed systems . The paper was recommended by the Programm Committee of the International Conference on Parallel Computing Technologies (PaVT-2010; http://agora.guru.ru/pavt) . ...

Еще в разделе: (Показать все результаты (>197) - num-meth.srcc.msu.ru/ )

• "Quantum chemical estimation of the fluoroacidity as a method to determine the
• "Methods of text fragment relevance estimation based on the topic model
• "Improvement of the rate of convergence estimates for some classes of

THE PARAMETERS INVOLVED IN HAPKE'S MODEL FOR ESTIMATION OF THE COMPOSITION OF THE EJECTA LUNAR TERRAINS. ... In the previous papers we were estimated the surface roughness of the ejecta lunar terrains by means comparison of the local phase function and the average integrated lunar indicatrix. ... The Hapke's theoretical model of the lunar surface reflection. ... For THE PARAMETERS INVOLVED IN HAPKE'S MODEL: S.G. Pugacheva, V.V. Shevchenko a low-albedo lunar surface parameter Bo = 1. ...

Еще в разделе: (Показать все результаты (>103) - selena.sai.msu.ru/ )

• http://selena.sai.msu.ru/Shev/Publications/ms38/ms083.pdf
• http://selena.sai.msu.ru/Pug/Publications/m44_70_pugacheva.pdf
• http://selena.sai.msu.ru/San/Publications/ms40/58_Leikin_Sanovich.pdf

... Sequence design of bioinspired copolymers with functionality on the nano-metre scale . Co-ordinator - Professor H.Tenhu . We adopt a biomimetic approach to design sequences in synthetic copolymers. ... 1) to undertake a detailed investigation of a number of methods to design non-random sequences of monomer units in copolymers with special emphasis on biomimetic approaches; . ... Professor . ... University of Helsinki, Department of Chemistry, . ... Moscow State University . ... RUSSIA . ...

Еще в разделе: (Показать все результаты (>320) - polly.phys.msu.ru/ )

• Seminar in Polymer Physics - 1996
• Семинар по физике полимеров 1996

... Поступление в лабораторию . ... Электронный журнал "Компьютерная графика и мультимедиа" . ... The estimation method is called robust if it can give accurate results in presence of noise and outliers. ... RANSAC-based methods turned out to be the most convenient tool for such problems as multiple-view relation estimation and camera calibration. ... But in such tasks as sequential camera pose estimation for image sequences, the noise is accumulated and its value is unknown. ...

Еще в разделе: (Показать все результаты (>141) - graphics.cs.msu.ru/ )

• Estimation of object's integral brightness | Graphics and Media Lab
• Age Estimation Using Additional Unlabeled Face Images | Graphics and Media Lab
• Short Reference Image Quality Estimation Using Modified Angular Edge Coherence

... Vol. ... Перспективы его развития в СНГ и в Восточной Европе. Ключевые слова: Частное образование. ... Отечественная и зарубежная литература. ... 2001. ... СТАТЬИ . ... Honolulu, 2002. ... Организация дистанционного образования в Гавайском университете. ... Ключевые слова: Информационные технологии в высшей школе. ОТДЕЛЬНЫЕ УНИВЕРСИТЕТЫ . ... ЗАРУБЕЖНЫЕ УНИВЕРСИТЕТЫ. ЕВРОПА. ... Ключевые слова: Связь университетов с промышленностью. ... Ключевые слова: Наука в университетах. ... 2002. ...

Еще в разделе: (Показать все результаты (>87) - srcc.msu.ru/ )

• University Information System RUSSIA

... Meta Data Syntax . ... Topic data not editable from main freeform text box, stored in name/value META variable pairs . ... Example of Format % nop META :TOPICINFO{version= 1.6 date= 976762663 author= PeterThoeny format = 1.0 }% text of the topic % nop META :TOPICMOVED{from= Codev.OldName to= CoDev.NewName by= JohnTalintyre date= 976762680 }% % nop META :TOPICPARENT{ name = NavigationByTopicContext }% % nop META :FILEATTACHMENT{ ... A topic name - the topic is a Form Template ....

Еще в разделе: (Показать все результаты (>24219) - dualopt1.cmm.msu.ru/ )

Next: BH+BH merging Up: The Present Situation in Previous: Observational Data . At present, it is possible to estimate binary NS merging rate in two ways: using the binary radiopulsar statistics observed and making various computations of binary stellar evolution. toPhinney,1991,ApJ, 380, L17 yr . ... 1991, ApJ, 397, L17 yr . ... toLipunov et al. ... We emphasize that although theoretical merging rates are systematically higher than observational ones, both estimates do not contradict each other. ...

Еще в разделе: (Показать все результаты (>308) - xray.sai.msu.ru/ )

• Binary Radiopulsars with Black Holes
• The Scenario Machine: Operational Guide
• Seminars