... Moons, Rings, and Unexpected Colors on Saturn . ... Credit: Cassini Imaging Team , SSI , JPL , ESA , NASA Explanation: Why would Saturn show such strange colors? The robotic Cassini spacecraft currently orbiting Saturn has beamed back images showing that the northern hemisphere our Solar System 's most spectacularly ringed planet has changed noticeably since Cassini arrived in 2004, now sporting unusual and unexpected colors. ... Publications with keywords: Saturn - cassini spacecraft . ...

Еще в разделе: (Показать все результаты (>72686) - www.astronet.ru/ )

• Астронет > Moons, Rings, and Unexpected Colors on Saturn
• An Unexpected Rocket Plume over San Francisco
• Unexpected X-rays from Comet Hyakutake

... 2008 October 20 . Moons, Rings, and Unexpected Colors on Saturn . Credit: Cassini Imaging Team , SSI , JPL , ESA , NASA . Explanation: Why would Saturn show such strange colors? The robotic Cassini spacecraft currently orbiting Saturn has beamed back images showing that the northern hemisphere our Solar System 's most spectacularly ringed planet has changed noticeably since Cassini arrived in 2004, now sporting unusual and unexpected colors. ... About APOD | ...

Еще в разделе: (Показать все результаты (>9153) - www.sai.msu.su/ )

• APOD: 2015 November 11 - An Unexpected Rocket Plume over San Francisco
• APOD: April 11, 1996 - Unexpected X-rays from Comet Hyakutake
• APOD: 2009 September 8 - Unexpected Impact on Jupiter

... Length = 194692 Score = 28.2 bits (14), Expect = 1.0 Identities = 14/14 (100%) Strand = Plus / Plus Query: 14 gggattcgaacccc 27 || ... Sbjct: 157615 cccttagcaggggcgcctcttcagcc 157640 Score = 26.3 bits (13), Expect = 4.1 Identities = 13/13 (100%) Strand = Plus / Plus Query: 14 gggattcgaaccc 26 || Sbjct: 158927 gggattcgaaccc 158939 Score = 26.3 bits (13), Expect = 4.1 Identities = 13/13 (100%) Strand = Plus / Plus Query: 14 gggattcgaaccc 26 || ...

Еще в разделе: (Показать все результаты (>2784) - kodomo.cmm.msu.ru/ )

• http://kodomo.cmm.msu.ru/~vanilin/3_1/tRNA_blastn.txt
• http://kodomo.cmm.msu.ru/~contradiction/term3/bln_y.txt
• http://kodomo.cmm.msu.ru/~mmetelev/Term3/bln.txt

... Online Services | ... Construct your query and output by sequental openings of needed fields. One output field must be selected (not be blank) at least. ... Query parameters: . Select for output . ... Energy (keV) . ... Y D H M S MS US NS PS FS AS EV KEV MEV or Stable . ... Energy of the ?-ray (keV) . ... Energy parameters of nucleus (B , Alpha energy, N, P separation energy) . ... Neutron separation energy (keV) . Proton separation energy (keV) . ... Excited energy(keV) . ...

Еще в разделе: (Показать все результаты (>14) - cdfe.sinp.msu.ru/ )

... December 30, 1998 . Supernova 1994D and the Unexpected Universe . Credit: High-Z Supernova Search Team , HST , NASA . Explanation: Far away, long ago, a star exploded. ... Supernova 1994D was not of interest for how different it was, but rather for how similar it was to other supernovae . ... The large number and great distances to supernovae measured in 1998 have been interpreted as indicating that we live in a previously unexpected universe . ... About APOD > . ... NASA Technical Rep.: ...

Еще в разделе: (Показать все результаты (>132) - www.arcetri.astro.it/ )

• APOD: 2000 March 12 - Supernova 1994D and the Unexpected Universe
• APOD: October 4, 1995 - The Sun Spews X-rays

Next: The Present Situation in Up: No Title Previous: Case A: . Why it is possible that the Oppenheimer-Volkoff limit exceeds ? ... The lifetime of HSP (``hot'' spinar) is completely determined by the cooling time which is of the order of s according to different calculations. ... It seems very attractive to identify this cooling time with the mean characteristic gamma-ray burst duration s! . ... Finally, for the high Oppenheimer-Volkoff limit for the cool non-rotating object, when . ...

Еще в разделе: (Показать все результаты (>376) - xray.sai.msu.ru/ )

05 Nov 2003 The Sun has continued its recent high levels of activity. At 1950 UT, 4 November 2003, a class X28 solar flare was released by the Sun. ... LASCO C2 Images of X28 Flare at 1950UT 04/11/2003 . ... SOHO (Solar and Heliospheric Observatory) is located between the Sun and the Earth and will, therefore, detect activity before it reaches the Earth. ... All this ongoing solar activity means that the Earth is destined to be bathed in more radiation - generating further auroral displays. ...

Еще в разделе: (Показать все результаты (>93) - www.kosmofizika.ru/ )

... MG1655, complete genome. (927 letters) Database: pm 204 sequences; 2,269,587 total letters Searching..................................................done Score E Sequences producing significant alignments: (bits) Value AE006203 Pasteurella multocida subsp. multocida str. Pm70 sectio.. ... 28 6.5 AE006163 Pasteurella multocida subsp. multocida str. ... Length = 10697 Score = 30.2 bits (15), Expect = 1.6 Identities = 15/15 (100%) Strand = Plus / Plus Query: 193 cgcatgattctgctt 207 || ...

Еще в разделе: (Показать все результаты (>8651) - kodomo.fbb.msu.ru/ )

• http://kodomo.fbb.msu.ru/~element/Term3/pm.txt
• http://kodomo.fbb.msu.ru/~element/Term3/search_3T.txt
• http://kodomo.fbb.msu.ru/~podkovkina/v.txt

Электронная библиотека Попечительского совета . ... Friberg J. - Unexpected Links Between Egyptian And Babylonian Mathematics . ... Название: Unexpected Links Between Egyptian And Babylonian Mathematics . ... Mesopotamian mathematics is known from a great number of cuneiform texts, most of them Old Babylonian, some Late Babylonian or pre-Old-Babylonian, and has been intensively studied during the last couple of decades. ... Электронная библиотека попечительского совета мехмата МГУ , 2004-2016 . ...

Еще в разделе: (Показать все результаты (>14286) - lib.mexmat.ru/ )

• Поиск книг, содержащих Математическое ожидание (expectation или expected value)
• Поиск книг, содержащих 'Математические досуги' (The Unexpected Hanging and
• Поиск книг, содержащих Expected running time :: Электронная библиотека

... Кафедра общей экологии Биологического факультета МГУ им. М.В. Ломоносова и . ... Экологический Форум - Фундаментальная Экология : Предложения и замечания по сайту . Тема: Luxury expected the foundation in is the . ... a href=http://celineforyou.zohosites.com/><b>Celine bags</b></a> th. ... a href=http://cheapcelines.zohosites.com/><b>Celine handbags</b></a> The growth in popularity of Louis Vuitton was so great that between 1987 and 1988 profits rose by 49%. ... http://www.isabelmarantmybest.com . ...

Еще в разделе: (Показать все результаты (>5112) - www.sevin.ru/ )

• Экологический Форум - Фундаментальная Экология: 80,000 March, expected are
• Экологический Форум - Фундаментальная Экология: to expected information exotic
• Экологический Форум - Фундаментальная Экология: the luxury definition expected

... For example, any option which requires a parameter is such a case. ... Postel & Reynolds [Page 2] RFC 855 May 1983 Thus, for option "ABC", which requires subnegotiation, the formats of the TELNET commands are: IAC WILL ABC Offer to use option ABC (or favorable acknowledgment of other party's request) IAC DO ABC Request for other party to use option ABC (or favorable acknowledgment of other party's offer) IAC SB ABC <parameters> IAC SE One step of subnegotiation, used by either party. ...

Еще в разделе: (Показать все результаты (>17524) - mirror.msu.net/ )

• http://mirror.msu.net/pub/rfc-editor/rfc-ed-all/pdfrfc/rfc855.txt.pdf
• http://mirror.msu.net/pub/rfc-editor/rfc-ed-all/rfc930.txt
• http://mirror.msu.net/pub/rfc-editor/rfc-ed-all/pdfrfc/rfc930.txt.pdf

. [ Войти ] . Главная -> Фильмы -> Tales of the Unexpected . Пользователи . Демо . Деньги . Фильмы . Форум . Tales of the Unexpected . Великобритания 1979 . отметить . Сериал . Ужасы . Триллер .

Еще в разделе: (Показать все результаты (>200) - kinfo.ru/ )

• The Unexpected Pest - Фильмы - Kinfo.ru
• An Unexpected Love - Фильмы - Kinfo.ru
• The Unexpected Mrs. Pollifax - Фильмы - Kinfo.ru

... MPI_Cancel . Cancels a communication request #include "mpi.h" int MPI_Cancel( request ) MPI_Request *request; . ... When the computation completes, some of these receive requests may remain; using MPI_Cancel allows the user to cancel these unsatisfied requests. ... All MPI routines (except MPI_Wtime and MPI_Wtick ) return an error value; C routines as the value of the function and Fortran routines in the last argument. ... By default, this error handler aborts the MPI job. ... Центры . ...

Еще в разделе: (Показать все результаты (>489) - www.parallel.ru/ )

• Non-destructive Test of status | PARALLEL.RU - Информационно-аналитический
• Client/Server Examples | PARALLEL.RU - Информационно-аналитический центр по
• Independence of Basic Runtime Routines | PARALLEL.RU -

... Length=2222430 Score = 55.4 bits (60), Expect = 6e-08 Identities = 53/68 (78%), Gaps = 0/68 (0%) Strand=Plus/Plus Query 141 TTACTGGGCGTAAAGCGCACGCAGGCGGTTTGTTAAGTCAGATGTGAAATCCCCGGGCTC 200 || Sbjct 1090874 TTACTGGGCTTAAAGCGCCCGTAGCCGGCCCGGCAAGTCGCTCCTGAAATCCCCGGGCTC 1090933 Query 201 AACCTGGG 208 || ... Sbjct 2071246 AGCCGCGGTAATACGG 2071261 Score = 28.3 bits (30), Expect = 8.9 Identities = 15/15 (100%), Gaps = 0/15 (0%) Strand=Plus/Plus Query 222 ACTGGCAAGCTTGAG 236 || ...

Еще в разделе: (Показать все результаты (>19) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/blast_default.out

... The command to be executed can be given to pppd with the connect command line option. pppd will redirect the command's standard input and output to the serial line. ... Basically, a chat script consists of an alternating sequence of strings that we expect to receive from the remote system, and the answers we are to send. ... This is a typical excerpt from a chat script; ogin: b1ff ssword: s3kr3t This tells chat to wait for the remote system to send the login prompt, and return the login name b1ff. ...

Еще в разделе: (Показать все результаты (>310) - itpm.msu.su/ )

• The Login Chat

... The aim of this project is the development of a new group of "smart" or intelligent materials, i.e. materials capable to follow small change of external conditions in a preset way. ... They represent a new type of composites consisting of small magnetic particles dispersed within a highly elastic polymeric matrix. ... Another straightforward application of the magnetic composites which will be implemented in the course of this project is based on their magnetic field dependent elastic modulus. ...

Еще в разделе: (Показать все результаты (>237) - polly.phys.msu.ru/ )

• NATO Scientific Environmental Affairs

... Пользователи -General- Common Current University Society Study Diaspora FAQ Real Estate -Technical- Development Hard&Soft Network Mobile -Market- Market Services Job -Hobby- Behemoth Health Love&Sex Еда Media Games Auto&Moto Sport Hobby Flood Zone -Servant- Alternative Forums Forum -Garbage- Revolution Garbage Private . Hobby >> Media >> The Hobbit : An Unexpected Journey . ... The Hobbit : An Unexpected Journey [ re: SuperBizZzon ] . ... Re: The Hobbit : An Unexpected Journey [ re: snowman ] . ...

Еще в разделе: (Показать все результаты (>1679) - www.snto-msu.net/ )

• [php] "Unexpected $end" - не могу понять что за ошибка - Public forum of MSU
• wine 1.0 released - Public forum of MSU united student networks

... Пользователи -General- Common Current University Society Study Diaspora FAQ Real Estate -Technical- Development Hard&Soft Network Mobile -Market- Market Services Job -Hobby- Behemoth Health Love&Sex Еда Media Games Auto&Moto Sport Hobby Flood Zone -Servant- Alternative Forums Forum -Garbage- Revolution Garbage Private . Hobby >> Media >> The Hobbit : An Unexpected Journey . ... The Hobbit : An Unexpected Journey [ re: SuperBizZzon ] . ... Re: The Hobbit : An Unexpected Journey [ re: snowman ] . ...

Еще в разделе: (Показать все результаты (>2839) - www.fds-net.ru/ )

PLTT DISCLAIMER: The PLTT makes no claims of ownership on the copyrighted works of O(+>, the artist formerly known as Prince, aka Prince Rogers Nelson. ... The PLTT, completely through voluntary work, hopes to provide the most comprehensive database of lyrics for the known works of this artist. ... We hope you enjoy our efforts, and contribute by making errors and opinions known to the PLTT by sending mail to pltt@umich.edu. (c) Copyright 1999 Prince Lyric Transcription Team ...

Еще в разделе: (Показать все результаты (>2887) - crydee.sai.msu.ru/ )

• http://crydee.sai.msu.ru/ftproot/pub/rec/games/idgames/levels/doom/a-c/cerberus.txt
• http://crydee.sai.msu.ru/ftproot/pub/rec/games/idgames/levels/doom/d-f/fy1a.txt
• http://crydee.sai.msu.ru/ftproot/pub/rec/games/idgames/levels/doom/m-o/marble1.txt

. You often enter the name of a file or directory as part of a command. You can complete the file or directory name automatically by entering the the first few characters of its name and then pressing a particular key. This feature is available with all shells except the Bourne shell. Finding out which shell you are using . Filename completion with the C shell . Filename completion with the TC shell . Filename completion with the Korn shell . Filename completion with the Bourne Again SHell .

Еще в разделе: (Показать все результаты (>140) - comet.sai.msu.ru/ )

• Filename completion with the Korn shell
• Filename completion with the C shell
• Filename completion with the TC shell