... Length = 4214630 Score = 44.1 bits (22), Expect = 1e-05 Identities = 22/22 (100%) Strand = Plus / Plus Query: 46 ggtcggtggttcgagtccactc 67 || Sbjct: 31975 ggtcggtggttcgagtccactc 31996 Score = 44.1 bits (22), Expect = 1e-05 Identities = 22/22 (100%) Strand = Plus / Plus Query: 46 ggtcggtggttcgagtccactc 67 || Sbjct: 11507 ggtcggtggttcgagtccactc 11528 Score = 40.1 bits (20), Expect = 2e-04 Identities = 20/20 (100%) Strand = Plus / Minus Query: 8 tagctcagttggttagagca 27 || ...

Еще в разделе: (Показать все результаты (>3351) - kodomo.cmm.msu.ru/ )

• http://kodomo.cmm.msu.ru/~christablel/term3/blastn.1fasta
• http://kodomo.cmm.msu.ru/~pavel_s/term3/blastn.txt
• http://kodomo.cmm.msu.ru/~golikov_v/practices/aj223173.out

... MG1655, complete genome. (927 letters) Database: pm 204 sequences; 2,269,587 total letters Searching..................................................done Score E Sequences producing significant alignments: (bits) Value AE006203 Pasteurella multocida subsp. multocida str. Pm70 sectio.. ... 28 6.5 AE006163 Pasteurella multocida subsp. multocida str. ... Length = 10697 Score = 30.2 bits (15), Expect = 1.6 Identities = 15/15 (100%) Strand = Plus / Plus Query: 193 cgcatgattctgctt 207 || ...

Еще в разделе: (Показать все результаты (>9437) - kodomo.fbb.msu.ru/ )

• http://kodomo.fbb.msu.ru/~element/Term3/pm.txt
• http://kodomo.fbb.msu.ru/~element/Term3/search_3T.txt
• http://kodomo.fbb.msu.ru/~ogion/projects/Evolution_of_sequences/hemn_yp.blast

... Length=2222430 Score = 55.4 bits (60), Expect = 6e-08 Identities = 53/68 (78%), Gaps = 0/68 (0%) Strand=Plus/Plus Query 141 TTACTGGGCGTAAAGCGCACGCAGGCGGTTTGTTAAGTCAGATGTGAAATCCCCGGGCTC 200 || Sbjct 1090874 TTACTGGGCTTAAAGCGCCCGTAGCCGGCCCGGCAAGTCGCTCCTGAAATCCCCGGGCTC 1090933 Query 201 AACCTGGG 208 || ... Sbjct 2071246 AGCCGCGGTAATACGG 2071261 Score = 28.3 bits (30), Expect = 8.9 Identities = 15/15 (100%), Gaps = 0/15 (0%) Strand=Plus/Plus Query 222 ACTGGCAAGCTTGAG 236 || ...

Еще в разделе: (Показать все результаты (>16) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast.out

... Some sites have implemented dictionary lookup techniques in their password programs to prevent ordinary words from being used. ... A version of the PWDGEN algorithm briefly described below has been in use for several years at a small number of sites in the Internet. ... The PWDGEN Service described herein provides a means for sites to offer a list of possible passwords for the user to choose one from the first set, or optionally select from another set. ...

Еще в разделе: (Показать все результаты (>17240) - mirror.msu.net/ )

• Index of /pub/gentoo-portage/dev-tcltk/expect/files/
• Index of /pub/gentoo-portage/dev-tcltk/expect/
• Index of /pub/gentoo-portage/dev-python/expects/

... Unexpected Galaxy String in the Early Universe . ... 20.01.2004 . ... NSF , NASA Explanation: How could such a long string of galaxies form so early in the universe? Several new measurements of galaxies and clusters in the early universe are reporting structures involving galaxies and clusters that are larger than expected with the new standard "dark-energy" cosmology . ... Publications with keywords: galaxies - early universe . Publications with words: galaxies - early universe . ...

Еще в разделе: (Показать все результаты (>4308) - www.astronet.ru/ )

• Астронет > Unexpected Galaxy String in the Early Universe
• J102815: A Star That Should Not Exist
• Journal "Peremennye Zvezdy"

... 2004 January 20 . Unexpected Galaxy String in the Early Universe . ... Explanation: How could such a long string of galaxies form so early in the universe? Several new measurements of galaxies and clusters in the early universe are reporting structures involving galaxies and clusters that are larger than expected with the new standard "dark-energy" cosmology . The controversy centers on the inability of a dark-energy dominated universe to create such large structures. ... About APOD | ...

Еще в разделе: (Показать все результаты (>1635) - www.sai.msu.su/ )

• APOD: 2011 September 7 - J102815: A Star That Should Not Exist
• APOD: 2009 September 8 - Unexpected Impact on Jupiter
• APOD: 2008 January 1 - Rays from an Unexpected Aurora

... Экологический Форум - Фундаментальная Экология : Предложения и замечания по сайту . Тема: regulate concerns expected and imported t . ... a href=http://celinecountry.webs.com/><b>Celine bags</b></a> Not all the Hermes Bags Wikipedia Hermes Bags Wholesale manufacturers?care for perfection and style as does the Chanel. this website. ... Переход на форум -- Выберите форум -- О сайте "Фундаментальная экология" - Предложения и замечания по сайту Научные семинары - Научные семинары . ...

Еще в разделе: (Показать все результаты (>2176) - www.sevin.ru/ )

• Экологический Форум - Фундаментальная Экология: to expected information exotic
• Экологический Форум - Фундаментальная Экология: course, million expected rules"
• Экологический Форум - Фундаментальная Экология: Friday was expected to be the

... Above, we already encountered the login chat script, which tells uucico how to log into the remote system. ... The intention is to make uucico wait until the remote machine sends a login prompt, then return the login name, wait for the remote system to send the password prompt, and send the password. Expect and send strings are given in alternation. uucico automatically appends a carriage return character (r) to any send string. Thus, a simple chat script would look like . ...

Еще в разделе: (Показать все результаты (>281) - itpm.msu.su/ )

• Dialing out with chat
• UUCP Setup
• The paths database

... Nonlinearity of Sound Wave Propagation and Stimulated Brillouin Scattering Process . A.I.Erokhin (Nonlinear Optics and Light Scattering Laboratory, Lebedev Physical Institute, Moscow, Russia) . ... Hypersound intensity in SBS process usually exceeds some kW/cm2 and is naturally expected to reveal nonlinear features. ... It causes the atypical acoustic nonlinearity appearance. ... New experimental approaches for investigation of intense hypersound propagation in liquids have been tried. ...

Еще в разделе: (Показать все результаты (>152) - acs366.phys.msu.su/ )

. [ Войти ] . Главная -> Фильмы -> Expecting . Пользователи . Демо . Деньги . Фильмы . Форум . Expecting . Канада 2002 . отметить . Комедия . Драма .

Еще в разделе: (Показать все результаты (>180) - kinfo.ru/ )

• Expecting Love - Фильмы - Kinfo.ru
• Tales of the Unexpected - Фильмы - Kinfo.ru
• The Unexpected Pest - Фильмы - Kinfo.ru

... Nor can the idea of intercultural communication be limited (as it was ? ... The department for discourse and communication studies in the School of Philology of Moscow Lomonosov University strives to provide for advanced level of verbal and visual (media) literacy, enabling students to combine critical and creative objectives, develop sophisticated analytical perspectives on the intersections of media, culture, translation, speech communication practices and social analysis. ... Mass culture ? ...

Еще в разделе: (Показать все результаты (>173) - www.philol.msu.ru/ )

Электронная библиотека . механико-математического факультета . ... Главная Ex Libris Книги Журналы Статьи Серии Каталог Wanted Загрузка ХудЛит Справка Поиск по индексам Поиск . ... Поиск по указателям . Результат поиска . Книга . Страницы для поиска . Секей Г. - Парадоксы в теории вероятностей и математической статистике . ... Электронная библиотека попечительского совета мехмата МГУ , 2004-2016 . ...

Еще в разделе: (Показать все результаты (>5588) - lib.mexmat.ru/ )

• Поиск книг, содержащих 'Математические досуги' (The Unexpected Hanging and
• Поиск книг, содержащих Expected running time :: Электронная библиотека
• Rothwell W.J. - What Ceos Expect From Corporate Training :: Электронная

... Пользователи -General- Common Current University Society Study Diaspora FAQ Real Estate -Technical- Development Hard&Soft Network Mobile -Market- Market Services Job -Hobby- Behemoth Health Love&Sex Еда Media Games Auto&Moto Sport Hobby Flood Zone -Servant- Alternative Forums Forum -Garbage- Revolution Garbage Private . Hobby >> Media >> The Hobbit : An Unexpected Journey . ... The Hobbit : An Unexpected Journey [ re: SuperBizZzon ] . ... Re: The Hobbit : An Unexpected Journey [ re: snowman ] . ...

Еще в разделе: (Показать все результаты (>1959) - www.snto-msu.net/ )

• [php] "Unexpected $end" - не могу понять что за ошибка - Public forum of MSU
• wine 1.0 released - Public forum of MSU united student networks

... Пользователи -General- Common Current University Society Study Diaspora FAQ Real Estate -Technical- Development Hard&Soft Network Mobile -Market- Market Services Job -Hobby- Behemoth Health Love&Sex Еда Media Games Auto&Moto Sport Hobby Flood Zone -Servant- Alternative Forums Forum -Garbage- Revolution Garbage Private . Hobby >> Media >> The Hobbit : An Unexpected Journey . ... The Hobbit : An Unexpected Journey [ re: SuperBizZzon ] . ... Re: The Hobbit : An Unexpected Journey [ re: snowman ] . ...

Еще в разделе: (Показать все результаты (>2804) - www.fds-net.ru/ )

• Продаю Ipod Touch 8Gb (1 generation) - Public forum of MSU united student
• Generate Java classes from XML Schema with WSDL2Java - Public forum of MSU

... 2000 March 12 . Supernova 1994D and the Unexpected Universe . Credit: High-Z Supernova Search Team , HST , NASA . Explanation: Far away, long ago, a star exploded. ... Supernova 1994D was not of interest for how different it was, but rather for how similar it was to other supernovae . ... The large number and great distances to supernovae measured over the past few years have been interpreted as indicating that we live in a previously unexpected universe . ... About APOD | ...

Еще в разделе: (Показать все результаты (>19) - www.arcetri.astro.it/ )

• APOD: December 30, 1998 - Supernova 1994D and the Unexpected Universe

... Полная версия этой страницы: EXPECT . Студенческий форум Физфака МГУ > Общий > Все обо всем > Цифровые технологии . GLAMURRRRRR . ... есть таккая штука под UNIX называица expeсt...па нему нету вроди как книжек нарускам..вот..может кто подскажет как мона ево асвоить..нада по работе. ivandasch . ... чето такое помню, што пользовался для чего-то им, но не помню... =( врде как автоматизация в шелле работы с телнет и всякими прогами типа консолных... но мож ошибаюсь, знакомо вобщем. man expect . ...

Еще в разделе: (Показать все результаты (>166) - wasp.phys.msu.ru/ )

• EXPECT - Студенческий форум Физфака МГУ

Contemporary media environment is formed by dense concentration and interaction of cultures, languages, channels and modalities of communication. ... Across this new terrain, rich, exciting and risky, the new generation of media practitioners, teachers, researchers and public intellectuals is expected to navigate competently and creatively. ... Nor can the idea of intercultural communication be limited (as it was тАУ only recently) to relatively formal contact between established national cultures. ...

Еще в разделе: (Показать все результаты (>5) - discours.philol.msu.ru/ )

Supernova 2003bv in MCG +7-15-15 . This page is devoted to information on Supernova 2003bv in MCG +7-15-15 Basic information on this SN, including the last reported brightness, on this Supernova can be found on the main page . Information on the original web pages for many of these images can be found on the updates and links web pages. ... Web pages dedicated to this SN. SNWeb has a 2003bv page . ... Image Credit . ... Discovery image . 2003/03/11.995 . ... Light curves and Spectra: . ...

Еще в разделе: (Показать все результаты (>271) - www.rochesterastronomy.org/ )

• Supernova 1999dq in NGC 976

... Mon May 28 13:12:21 MSK 2012 . Previous message: [RU-NGI] password for https://lcg05.sinp.msu.ru/nagios . Next message: [RU-NGI] password for https://lcg05.sinp.msu.ru/nagios . ... Sun, May 27, 2012 at 11:02:06PM +0100, Lev Shamardin wrote: > Проблемы со стороны GOCDB (и не только с логинами). ... Похоже, что-то починили: {{{ GOCDB experienced an unexpected downtime between Friday 25.05.12 19.15 and Monday 28.05.12 07.45 (all times UTC). ... More information about the RU-NGI mailing list . ...

Еще в разделе: (Показать все результаты (>1149) - theory.sinp.msu.ru/ )

• Interaction of the Higgs doublet with fermions and generation of fermion masses
• intas:cern-intas03:task3 [THEP]
• intas:cern-intas03:task4 [THEP]

D.Moss, D.Sokoloff, Seed fields for galactic dynamos, Astron. Astrophys. ... 27, N2, 139 - 144, 2012. We demonstrate that a uniform cosmological seed field is a much less suitable seed field for a galactic dynamo than has often been expected. The age of the Universe is insufficient for a conventional galactic dynamo to generate a contemporary galactic magnetic field starting from such a seed, accepting conventional estimates for physical quantities. ...

Еще в разделе: (Показать все результаты (>42) - srcc.msu.ru/ )