... Online Services | ... Construct your query and output by sequental openings of needed fields. One output field must be selected (not be blank) at least. ... Query parameters: . Select for output . ... Energy (keV) . ... Y D H M S MS US NS PS FS AS EV KEV MEV or Stable . ... Energy of the ?-ray (keV) . ... Energy parameters of nucleus (B , Alpha energy, N, P separation energy) . ... Neutron separation energy (keV) . Proton separation energy (keV) . ... Excited energy(keV) . ...

Еще в разделе: (Показать все результаты (>5244) - cdfe.sinp.msu.ru/ )

• CDFE => Online Services => Nuclear Reaction Threshold and Energy Values
• CDFE => Online Services => Calculator and Graph Engine for Atomic Nuclei

Core information (Nucleus, Levels, Gamma transition, Decays, Data type) . ... any adopted (levels and gammas only) experimental . ... Query parameters: . Select for output . ... Levels (E, JPI, T1/2, etc.) ... Energy (keV) . ... Y D H M S MS US NS PS FS AS EV KEV MEV or Stable . ... Energy of the ?-ray (keV) . Relative photon intensity . ... Energy parameters of nucleus (B , Alpha energy, N, P separation energy) . ... Neutron separation energy (keV) . Proton separation energy (keV) . ...

Еще в разделе: (Показать все результаты (>4) - depni.sinp.msu.ru/ )

Analysis of the ANTARES data for SN neutrino detection V. Kulikovskiy (MSU / INFN Genova) Hit counts in the detector. The number of hits ( hit counts ) in a time slice (104.8 ms) is used (this information is stored in each run) Mean number of hit counts in one PMT is ~5500 (corresponds to ~55 kHz) Expected number of hits from SN in 100ms is 11.6 ( 550 0) Bioluminescence bursts should be excluded Bioluminescence cut We have collected distributions of hit counts for each ...

Еще в разделе: (Показать все результаты (>26) - antares.sinp.msu.ru/ )

• http://antares.sinp.msu.ru/docs/Gracheva_Bamberg_22.09.11.pdf

Brownian simulation of electron transfer dynamics" . Feskov S.V. Several algorithms for the numerical simulation of electron transfer reactions in condensed media within the framework of the generalized Zusman model are considered. ... The work was supported by the Russian Foundation for BasiЯ Research (project N 08?03?00534). Keywords: Brownian simulations, diffusive trajectory, chemical dynamics, electron transfer . ... PDF (in Russian) (332KB) . PostScript. zip (in Russian) (332KB) . ...

Еще в разделе: (Показать все результаты (>608) - num-meth.srcc.msu.ru/ )

• Intermittency of vector fields and natural random number generators
• Composition of infinitary structures
• "Stationary distribution of product of matrices with random coefficients"

... Schroeder M. - Number theory in science and communication: with applications in cryptography, physics, digital information, computing, and self-similarity . ... Название: Number theory in science and communication: with applications in cryptography, physics, digital information, computing, and self-similarity . ... If nothing else, the advent of the digital computer and digital communication has seen to that. ... computer science, digital communication, cryptography and more playful things, . ...

Еще в разделе: (Показать все результаты (>17336) - lib.mexmat.ru/ )

• Baker A. - Algebra and Number Theory :: Электронная библиотека попечительского
• Mackey G. - Unitary Group Representations in Physics, Probability and Number
• Cohen L.W., Ehrlich G. - The Structure of the Real Number System :: Электронная

1950 (350 Kb); Oil on canvas, Oil, enamel, and aluminum on canvas; 221 x 300 cm (7 ft 3 in x 9 ft 10 in); National Gallery of Art, Washington, D.C. Pollock was the first ``all-over'' painter, pouring paint rather than using brushes and a palette, and abandoning all conventions of a central motif. ... Lavender Mist is 3 m long (nearly 10 ft), a vast expanse on a heroic scale. ... Thanks to the BMW Foundation , the WebMuseum mirrors , partners and contributors for their support. ...

Еще в разделе: (Показать все результаты (>3380) - www.sai.msu.su/ )

• SAL- Mathematics - Number Theory
• SAL- Mathematics - Number Theory - SIMATH
• FTS Dictionary Example

... Traditionally, UUCP talks of dialers rather than modems, because in earlier times, it was usual practice to have one (expensive) automatic dialing device serve a whole bank of modems. ... Similar to the login chat, it consists of a sequence of strings uucico sends to the dialer and the responses it expects in return. ... When uucico detects a chat-fail string while executing the modem chat, it aborts the call, and logs the error message in the UUCP log file. ...

Еще в разделе: (Показать все результаты (>483) - itpm.msu.su/ )

• Telephone Number
• Dialing out with chat
• worker - Apache HTTP Server

The processes of electron-positron annihilation into photon pairs and of pair creation by photons are of interest both theoretically and experimentally. ... This should come as some surprise since you probably know that by crossing you should expect each of the two Compton diagrams to give rise to one Feynman diagram for the annihilation process (see, for instance, [ 2 ] Section 7.8, [ 1 ] Section 6.15). ... see section ) and hence get the following formula for the total cross section: . ...

Еще в разделе: (Показать все результаты (>2568) - theory.sinp.msu.ru/ )

• CompHEP
• QCD scale
• [RU-NGI] Fwd: Fwd: NOTIFICATION on GGUS-Ticket-ID: # 114235 "ASSIGNED"

... Universe Size . ... When a user (or possibly a batch system) runs one of these quasi-static applications, she will usually specify a number of processes to start and a total number of processes that are expected. ... MPI provides an attribute on MPI_COMM_WORLD, MPI_UNIVERSE_SIZE, that allows the application to obtain this information in a portable manner. ... An application typically subtracts the size of MPI_COMM_WORLD from MPI_UNIVERSE_SIZE to find out how many processes it should spawn. ...

Еще в разделе: (Показать все результаты (>570) - www.parallel.ru/ )

• Version Number | PARALLEL.RU - Информационно-аналитический центр по
• MPE_Log_get_event_number | PARALLEL.RU - Информационно-аналитический центр по
• MPI_Type_create_indexed_block | PARALLEL.RU - Информационно-аналитический центр

... Floating point numbers (AKA "floats", "doubles" or "real numbers") can be specified using any of the following syntaxes: . a = 1.234; $a = 1.2e3; $a = 7E-10; The size of a float is platform-dependent, although a maximum of ~1.8e308 with a precision of roughly 14 decimal digits is a common value (that's 64 bit IEEE format). ... It is quite usual that simple decimal fractions like 0.1 or 0.7 cannot be converted into their internal binary counterparts without a little loss of precision. ...

Еще в разделе: (Показать все результаты (>787) - oit.cmc.msu.ru/ )

• Integers
• Dealing with a Variable Number of Arguments/Optional Parameters
• Retrieving Arguments

... Run program . User's guide . Launching program . Input data format . ... Selecting the number of correlated pairs . ... In order to run thr program one needs Java 5.0 environment. ... At the end of computations one will be asked to review the selected number of correlated pairs. ... Note: One may redefine the number of correlated pairs by selecting the 'Edit' -> 'redefine correlated pairs number' menu item. Correlated pairs of positions are presented as a colored matrix, the heatmap. ...

Еще в разделе: (Показать все результаты (>138) - bioinf.fbb.msu.ru/ )

• RNA kinetics server
• RNA Kinetics: Result explanation
• SDPsite - Algorithm Format requirements

Next: The Model Up: No Title Previous: Radiopulsars as Sources of . In this section, we study the evolution of stellar populations on a time-scale of 10 Myr for a starburst љ occurring under conditions similar to those in the Galactic Center (see Lipunov et al. (1995d)[ 126 ]). We estimate the expected number of X-ray transient љ sources (NS + MS star), super accreting BH, and BH + supergiant binaries, all as functions of time elapsed after the burst. ...

Еще в разделе: (Показать все результаты (>650) - xray.sai.msu.ru/ )

• Number of accreting X-ray binaries of selected types
• The Number of Ejectors in Binaries
• Black Holes in Binaries

... Data . ... Solar energetic particles . ... Nucleon . ... Particle spectra at LEO . ... Overview ] [ Documentation ] [ SEP Events ] [ SEP Model ] . ... 1.2 High-energy heavy ions (Z = 6, 7, 8, 10, 12, 14, 16, and 26) by ACE spacecraft (SIS instrument) data are selected from: . ... The SEP events were selected by GOES-8 4th channel (15-40 MeV) data (see Fig.1). ... E тАУ ionтАЩs kinetic energy in MeV/nucl; Moc2 =938 MeV тАУ nucleon rest energy; †Я=v/c тАУ particleтАЩs relative velocity. ...

Еще в разделе: (Показать все результаты (>71) - smdc.sinp.msu.ru/ )

• ShielDose2 model - Space monitoring data center
• OMNIweb mirror - Space monitoring data center
• COSRAD model - Space monitoring data center

Network Working Group Request for Comment #167 NIC #6784 Socket Conventions Reconsidered Athay Bhushan (MAC) Bob Metcalfe (Harvard) Joel Winett (LL) 24 May 1971 Category: C1, C3, C8 Related RFCs: #147, #129 Related Functional Documents: #1 [Page 1] RFC 167 Socket Conventions Reconsidered The current NCP Protocol says nothing about how hosts should assign socket numbers to process ports, except that the low-order bit is to specify socket gender (i.e., send or receive). ...

Еще в разделе: (Показать все результаты (>18786) - mirror.msu.net/ )

• http://mirror.msu.net/pub/rfc-editor/rfc-ed-all/rfc167.txt
• http://mirror.msu.net/pub/rfc-editor/internet-drafts/draft-eddy-idr-flowspec-packet-rate-00.txt
• http://mirror.msu.net/pub/rfc-editor/rfc-ed-all/rfc5612.txt

... K. Krylov . There was undertaken a research of lengthes of marinon - some integral units obtained by segmenting of comleted (whole) fiction prosaic texts (stories, small novels, novels). ... Overall corpus of considereded texts (Russian fiction prosaic) contain more than two million of graphic running words. Undertaken research has lead us to revealing of three main regularities. 1) to formulation of the law of optimum relation between number of elements within each submicroscopic level; . ...

Еще в разделе: (Показать все результаты (>60) - old.philol.msu.ru/ )

• Large transportation networks with finite-dimensional state space. Asimptotic

... Length = 4214630 Score = 44.1 bits (22), Expect = 1e-05 Identities = 22/22 (100%) Strand = Plus / Plus Query: 46 ggtcggtggttcgagtccactc 67 || Sbjct: 31975 ggtcggtggttcgagtccactc 31996 Score = 44.1 bits (22), Expect = 1e-05 Identities = 22/22 (100%) Strand = Plus / Plus Query: 46 ggtcggtggttcgagtccactc 67 || Sbjct: 11507 ggtcggtggttcgagtccactc 11528 Score = 40.1 bits (20), Expect = 2e-04 Identities = 20/20 (100%) Strand = Plus / Minus Query: 8 tagctcagttggttagagca 27 || ...

Еще в разделе: (Показать все результаты (>3411) - kodomo.cmm.msu.ru/ )

• http://kodomo.cmm.msu.ru/~christablel/term3/blastn.1fasta
• http://kodomo.cmm.msu.ru/~pavel_s/term3/blastn.txt
• http://kodomo.cmm.msu.ru/~phoenix/term3/resultblastn2.txt

. In the current work the variability of the number of marginal flowers in inflorescences of 11 plant species from Compositae family depending on light and humidity level of the population and connection between the number of marginal flowers with other morphological characteristics of researched plants were studied. [full Russian text] . To the main page

Еще в разделе: (Показать все результаты (>219) - herba.msu.ru/ )

• Number of herbarium sheets of Dicotyledons in MW Herbarium
• Insect catching and carnivorous plants
• THE BEHAVIOUR OF LEAF TRAPS OF DROSERA ROTUNDIFOLIA L

... Number nine will put you on the spot. ... Naughty number nine. ... Is that it's one less than ten. You see, nine is the same as ten minus one. ... I mean, eight times nine is 80 minus eight, . And seven times nine is 70 minus seven, . And six times nine is 60 minus six. ... With naughty number nine. ... One times nine is nine, and two times nine is 18. Mean ol' number nine. ... Eight times nine is 72, and nine times nine is 81, . ... With naughty, nasty, mean ol' number nine. ...

Еще в разделе: (Показать все результаты (>4486) - crydee.sai.msu.ru/ )

• Three Is A Magic Number
• Number Theory 2003 RCD
• work on number

... Catalytic Reactions of hydrocarbons promoted by COordinatively unsaturated compounds of Zr AND Ti Density Functional Theory Study . Abstract The manuscrtipt reprezents the review of a series of publications by authors devoted to the number of homogeneous and heterogeneous catalytic reactions, their mechanisms and energy characteristics. ... Moscow University Chemistry Bulletin . 2009, Vol. ... Copyright (C) Chemistry Dept., ... Copyright (C) Chemisty Department of Moscow State University . ...

Еще в разделе: (Показать все результаты (>1224) - chem.msu.ru/ )

• Moscow University Chemistry Bulletin Vol. 42, No. 2, P. 92 (2001)
• Functionalization of Higher Fullerenes: Reactions With Transition Metal
• Moscow University Chemistry Bulletin Vol. 47, No. 3 (2006)

... Annex (e.g. 3.1) (3) Paragraph/ Figure/Table/ Note (e.g. Table 1) 4 Type of comment2 5 Comment (justification for change) by the MB Date: (6) Document: (7) Secretariat observations on each comment submitted Proposed change by the MB RU RU RU RU 2 2 2 2 Row 2 Row 4 Row 4 Row 5 ed ed ed te SEPs are not fluxes , but particles It is desirable to add that Wolf number is also known as the sunspot number. ... CLOSED: Accepted and implemented in modified form CLOSED: Accepted and RU 2 Row 16 . ...

Еще в разделе: (Показать все результаты (>9) - srd.sinp.msu.ru/ )