... A new method is proposed that makes it possible to determine the parameters of the three-dimensional (3D) multiwell potential of off-center atoms from extended X-ray absorption fine-structure (EXAFS) data. ... The parameters of the multiwell potential for Ge atoms in the Sn 1-x Ge x Te solid solution as functions of temperature and composition (77<T<300 K, x>0.4) were obtained in the classical approximation. ...

Еще в разделе: (Показать все результаты (>132) - scon155.phys.msu.su/ )

Online Services | ... Nuclear Wallet Cards" . USA National Nuclear Data Center - NNDC . ... Nuclei Selection: . All nuclei Only even Only odd . ... Decay Type: . decay . ... CDFE Head: Vladimir V. Varlamov . ...

Еще в разделе: (Показать все результаты (>29) - cdfe.sinp.msu.ru/ )

• CDFE => Online services => Chart of nucleus shape and size parameters
• CDFE => Online services => Chart of Nuclear Quadrupole Deformations
• CDFE - Centre for Photonuclear Experiments Data - Home page

... Stationary distribution for the Jacobi equation with a large random curvature parameter" . Illarionov E.A. A generalization of the results obtained previously for the case when the curvature parameter of the Jacobi equation is a random quantity distributed on a large or infinite interval is proposed. ... Keywords: stationary distribution, product of matrices, integral equation, Jacobi equation . ...

Еще в разделе: (Показать все результаты (>389) - num-meth.srcc.msu.ru/ )

• "Some features of solving the problems of mapping for allocation of chemical
• "Influence of genetic algorithm parameters on the docking efficiency with the
• "Methods of choosing a regularization parameter in the problem of linear

... The objects on the surface may be searched and then enumerated using the Command Enum Features . ... The average level, mean square deflection (in fig d) and maximum value are calculated for the surface. ... The new average level of the height of the surface is found when the selected objects are not accounted for. Then the average height of each selected objects is calculated as the average value among maximum values of the height for each line along X axis in respect to the new average level. ...

Еще в разделе: (Показать все результаты (>139) - www.spm.genebee.msu.ru/ )

• Actions with obtained files
• Scan parameters
• Index

Microsymposium 40, abstract 81, 2004 (letter format) THE MORPHOMETRIC ANALISYS OF THE FEATURES OF MARTIAN CRATERS (10 ­ 20 km). ... In the present work the morphometric parameters for 180 small martian craters (with diameters from 10 up to 20 km) [2] have been determined: depth of a crater- , height of a rim ­ h, with the help of profiles constructed on the basis of supervision of space vehicle MGS [3].The comparison with similar morphometric parameters of small lunar craters [5] also is fulfilled. ...

Еще в разделе: (Показать все результаты (>118) - selena.sai.msu.ru/ )

• http://selena.sai.msu.ru/Greg/Publications/ms38/ms090.pdf
• http://selena.sai.msu.ru/Pug/Publications/ms42/m42_60.pdf
• http://selena.sai.msu.ru/Symposium/ir_luna_e.pdf

. Starting version 0.9.7, the calendar is able to handle multiple dates selection, in either flat or popup form. For this to happen one needs to pass the " multiple: true " parameter to Calendar.setup and to install an onUpdate handler that watches for modifications. [open calendar...] . mishoo Last modified: Thu Mar 3 20:17:42 EET 2005

Еще в разделе: (Показать все результаты (>40319) - dualopt1.cmm.msu.ru/ )

• %TOPICTITLE% (18 vs. 19) - TWiki
• %TOPICTITLE% (2 vs. 3) - TWiki
• %TOPICTITLE% (6 vs. 7) - TWiki

... Mughabghab S.F. - Atlas of Neutron Resonances: Resonance Parameters and Thermal Cross Sections . ... Название: Atlas of Neutron Resonances: Resonance Parameters and Thermal Cross Sections . ... Compilation and evaluation of the world's thermal neutron cross-sections and resonance parameters for neutron physicists, reactor engineers, and neutron evaluators. ... Nuclear level density parameters derived from average spacings of neutron resonances following a new approach (new feature for this edition)....

Еще в разделе: (Показать все результаты (>11738) - lib.mexmat.ru/ )

• Bishwal J.P. - Parameter Estimation in Stochastic Differential Equations ::
• Hansen C.M., Durkee J. - Hansen Solubility Parameters: A User's Handbook ::
• Hisashi Tanizaki - Estimation of unknown parameters in nonlinear and

... we show that the comparison between the calculated and observed numbers of the most ``fragile'' (from the point of view of the binary evolution scenario )   galactic binary types (such as X-ray low-mass X-ray binaries (LMXB), cataclysmic variables (CV),   Be-stars   with compact companions, relative number of visible binary radiopulsars   with normal and compact secondary components) impose certain constraints on the feasible initial ... Phenomenological Kick Velocity . ...

Еще в разделе: (Показать все результаты (>472) - xray.sai.msu.ru/ )

• Dependence on the Scenario Parameters and Initial Distributions
• Effect of sources evolution on
• Initial binary parameters

... SPARCompiler(TM) Fortran 90 1.0 . FORTRAN 77 3.0.1 . ... important of these. -ansi: Report non-ANSI extensions. -c: Suppress linking, produce .o files -e: Recognize extended (132 character) source lines -fast: Specify common set of performance options - fixed : Interpret all Fortran source files according to fixed form rules -flags: Print summary of compiler options -fnonstd: Non-standard initialization of floating-point hardware -fnonstop: Execute without trapping on invalid, overflow ...

Еще в разделе: (Показать все результаты (>1778) - crydee.sai.msu.ru/ )

• Tutorial on Fortran 90, Digital UNIX
• NAG's Fortran 90

... 2.5 ISR 63 GeV |y| 2 NA5 19 GeV |y| 1.5 ISR 31 GeV |y| 2 N_ch 2 Regge-Gribov multipomeron approach Probability of production of n pomerons ' ' where n ­ cross section of n cut ... parameters used [1]: [1] Lakomov I. A., Vechernin V. V. , PoS (Baldin ISHEPP XXI) 072 (2012) 4 Regge-Gribov multipomeron approach Mean and variance of the number of pomerons: Variance Mean 5 Description of multiplicity Probability for n strings to give N ch ... Possible solution ­ string interactions. ...

Еще в разделе: (Показать все результаты (>192) - qfthep.sinp.msu.ru/ )

• http://qfthep.sinp.msu.ru/talks/QFTHEP-2010_-_Sukachev.pdf
• http://qfthep.sinp.msu.ru/talks/qfthep2010_dubinin.pdf
• http://qfthep.sinp.msu.ru/talks/QFTHEP2010Dolgopolov.pdf

COMPARISON OF CLUSTERING ALGORITHMS FOR SPEAKER IDENTIFICATION Nikolay Lubimov, Evgeny Mikheev, Alexey Lukin Moscow Lomonosov State University, Moscow, Russia In this paper we consider the problem of text-independent speaker identification that refers to acoustic recognition research. ... We have performed the comparison of different clustering methods for speaker identification: the standard K-means clustering, K-means++, Linde-Buzo-Gray, Fuzzy C-means, and Gustafson-Kessel algorithms. ...

Еще в разделе: (Показать все результаты (>230) - imaging.cmc.msu.ru/ )

• http://imaging.cs.msu.ru/pub/2008.cyprus.yurin_semeikina.plane.en.pdf

... Homepage: http://api.jqueryui.com/tooltip/ . ... To load the library into the current wiki page, add this somewhere on the page: %JQREQUIRE{"ui::tooltip"}% . This will initialize all DOM elements with a jqUITooltip css class and add a jQuery-ui tooltip to it. <a href="#" class="jqUITooltip" title="This is the tooltip content">hover me</a> . hover me . ... Name . ... Default . ... This topic: System > JQueryPlugin > JQueryUITooltip . ... Ideas, requests, problems regarding Foswiki? ...

Еще в разделе: (Показать все результаты (>5200) - wiki.cmc.msu.ru/ )

• CompareRevisionsAddOn < System < Foswiki
• VarINCLUDE < System < Foswiki
• VarURLPARAM < System < Foswiki

... The Study of Acoustic Nonlinearity Parameter Tomography in Reflection Mode . ... Based on the theory of propagation of reflected second harmonics in the layered medium and the insert-substitution method of finite amplitude sound wave, the computer simulation of nonlinearity parameter tomography from calculated reflected second harmonic data and filtered convolution algorithm used in the conventional CT technique is reported and the images of B/A for several biological specimens are reconstructed. ...

Еще в разделе: (Показать все результаты (>371) - acs366.phys.msu.su/ )

• Abstract (Invited)

. Kudryashov S.I. , Kravchenko O.V. , Khafizova G.M. , Burdina K.P. , Zorov N.B. and Kuzyakov Yu.Ya. Mendeleev Communications, p.75 (1998). Abstract . Intense laser vaporisation of amorphous carbon nitride of the composition C3N4.2-4.3 makes it possible to consider it as a promising precursor for obtaining the superhard crystalline phase of this compound, b-C3N4, by laser deposition. Laboratory of Laser Diagnostics

Еще в разделе: (Показать все результаты (>1346) - chem.msu.ru/ )

• Models of Water Diffusion in Silica Glass
• Comparative Analysis of Intramolecular Parameters of Nitrocompounds:
• Optimization of Optical Scheme Parameters in Dual-Beam Thermal Lens...

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>13) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search

... LanHEP version 3.2.0 (updated on Sep 30, 2015) source gzipped tar archive. ... LanHEP version 3.1.9 (updated on Nov 16, 2014) source gzipped tar archive. ... LanHEP version 3.1.8 (updated on July 21, 2013) source gzipped tar archive. ... LanHEP version 3.1.7 (updated on June 10, 2013) source gzipped tar archive. ... LanHEP version 2.0.7 (updated on May 24, 2002) source (gzipped tar archive) - the command line option '-mOmega' is implemented to produce the model files for micrOmega package. ...

Еще в разделе: (Показать все результаты (>1517) - theory.sinp.msu.ru/ )

• Parameterization via decay scheme
• Simplifying the expression for vertices
• Parameter section

diploma thesis abstract of Zjabko I.A. Anisotropy of a parameter of absorption in thin films of polymer polyparaphenilvenylene and donor-acceptor compositions on its basis In the present work are investigated thin a film of the connected polymer of a soluble derivative polyparaphenilvenylene (PPV). ... The received experimental curves are approximated by theoretical dependence and thus required values of optical constants are determined. ...

Еще в разделе: (Показать все результаты (>180) - ofvp.phys.msu.ru/ )

• http://ofvp.phys.msu.ru/en/science_education/diploma/annot/2013/Karnaukhov_Yakovlev_en.pdf
• http://ofvp.phys.msu.ru/en/science_education/diploma/annot/2015/Tsymbalov_Savel'ev_en.pdf

... New parameter parsing API: This chapter documents the new Zend parameter parsing API introduced by Andrei Zmievski. ... It greatly simplifies the process of receiving parameteres, but it has a drawback in that it can't be used for functions that expect variable number of parameters. ... The third argument is a string that specifies the number and types of arguments your function is expecting, similar to how printf format string specifies the number and format of the output values it should operate...

Еще в разделе: (Показать все результаты (>658) - oit.cmc.msu.ru/ )

• udm_set_agent_param
• Dealing with a Variable Number of Arguments/Optional Parameters
• Assuring Write Safety for Other Parameters

... About lab . ... Online Journal "Computer graphics and multimedia" (in russian) . ... Algorithms for calculating parameters of virtual scenes in computer vision tasks . ...

Еще в разделе: (Показать все результаты (>1090) - graphics.cs.msu.ru/ )

• Smart brightness and contrast correction | Graphics and Media Lab
• Smart brightness and contrast correction | Лаборатория компьютерной графики и
• x264 codec improvement | Graphics and Media Lab

... Category: Informational July 2013 ISSN: 2070-1721 Instant Messaging and Presence Purpose for the Call-Info Header Field in the Session Initiation Protocol (SIP) Abstract This document defines and registers a value of "impp" ("instant messaging and presence protocol") for the "purpose" header field parameter of the Call-Info header field in the Session Initiation Protocol (SIP). ... Saint-Andre Informational [Page 1] RFC 6993 Call-Info Purpose: IMPP July 2013 Table of Contents 1. ...

Еще в разделе: (Показать все результаты (>18340) - mirror.msu.net/ )

• http://mirror.msu.net/pub/rfc-editor/rfc-ed-all/pdfrfc/rfc6993.txt.pdf
• http://mirror.msu.net/pub/rfc-editor/rfc-ed-all/pdfrfc/rfc4508.txt.pdf
• http://mirror.msu.net/pub/rfc-editor/rfc-ed-all/rfc4508.txt