Lomonosov Moscow State University , Skobeltsyn Institute of Nuclear Physics . Online Services | ... Links | ... Contacts | ... CDFE => Online Services => Nucleus Ground and Isomeric States Parameters Search Engine . The source of data is the Nuclear Wallet Cards database prepared and maintained by the USA NNDC. ... Show nuclear moments/deformations for selected nuclei . ... Metastable states: . ... If you have any questions, comments, and/or suggestions, please, contact . ...

Еще в разделе: (Показать все результаты (>50) - cdfe.sinp.msu.ru/ )

• CDFE => Online services => Chart of nucleus shape and size parameters
• CDFE => Online Services => Relational ENSDF
• CDFE => Online services => Chart of Nuclear Quadrupole Deformations

Lomonosov project . ... Mikhail Lomonosov . Scientific goals . ... Magnetospheric particles and radiation conditions . ... Scientific equipment . ... ELFIN-L . ... It consist of a Flux Gate Magnetometer (FGM), an Energetic Particle Detector for Electrons (EPDE), and an Energetic Proton Detector for Ions (EPDI). ... Energetic particles create a hazardous environment for satellites and humans in space and cause a number of satellite failures. ... Magnetospheric particles and radiation environment . ...

Еще в разделе: (Показать все результаты (>40) - lomonosov.sinp.msu.ru/ )

• DEPRON | Университетский спутник "Ломоносов"

... Stroboscopic Pulse Method of Nonlinear Parameters Measurements . ... The method is based on application of ultrasonic pulses and low frequency vibration to the sample. The high frequency ultrasonic pulse time of flight is measured in different phases of the low frequency vibration. ... The experiment was conducted in a sandstone bar with the ultrasonic pulse, frequency 6 MHz, propagating across the bar and the low-frequency vibration excited along the bar. ...

Еще в разделе: (Показать все результаты (>660) - acs366.phys.msu.su/ )

• AUTHOR : Kazakov V
• AUTHOR : Gong X

... Publications . ... Number of publications 0 . ... Publication type . ... Borisov A. V. , Kazakov A. O. , Sataev I. R. The Reversal and Chaotic Attractor in the Nonholonomic Model of Chaplygin?s Top . Regular and Chaotic Dynamics, 2014, vol. 19, no. 6, pp. ... Borisov A. V., Kazakov A. O., Sataev I. R., Regular and Chaotic Attractors in the Nonholonomic Model of Chapygin's ball, Russian Journal of Nonlinear Dynamics, 2014, vol. 10, no. 3, pp. ... Institute of Computer Science Izhevsk, 2005 - 2016 . ...

Еще в разделе: (Показать все результаты (>219) - ics.org.ru/ )

New achievements in Development of Multidimensional Data Acquisition, Processing and Visualization DAQPROVIS M. MorhА *, 1, 2 , V. Matousek 1, 2 1, 3 , J. Kliman 1, 2 , 1 Institute of Physics, Slovak Academy of Sciences, Bratislava, Slovakia 2 Flerov Laboratory of Nuclear Reactions, JINR, Dubna, Russia 3 Laboratory of High Energies, JINR, Dubna, Russia * E-mail: morhac@savba.sk ACAT - 2002 I. Turzo c 1, 3 , . ... The channels are displayed as balls. ... Four-parameter experimental spectrum. ...

Еще в разделе: (Показать все результаты (>65) - acat02.sinp.msu.ru/ )

... When using a multidimensional parameter space, it is often impossible to establish frame bounds daubechies:CBMS on the energy in the parameter space. With only one parameter, we cannot always reconstruct the signal. ... To the extent that multi-dimensional parameter spaces are still useful, we will not let this infinite energy hinder our progress...``time-frequency-scale-chirprate . ... In general, g ( t ) is a complex-valued function of a real variable, and has finite energy: 6#6... affine . ...

Еще в разделе: (Показать все результаты (>818) - crydee.sai.msu.ru/ )

• Notation
• The Frequency-Frequency (FF) Plane
• Tutorial on Fortran 90, Digital UNIX

Электронная библиотека Попечительского совета . ... Bishwal J.P. - Parameter Estimation in Stochastic Differential Equations . ... Название: Parameter Estimation in Stochastic Differential Equations . ... Parameter estimation in stochastic differential equations and stochastic partial differential equations is the science, art and technology of modelling complex phenomena and making beautiful decisions. ... Электронная библиотека попечительского совета мехмата МГУ , 2004-2016 . ...

Еще в разделе: (Показать все результаты (>8775) - lib.mexmat.ru/ )

• van der Heijden F., Duin R., de Ridder D. - Classification, Parameter
• Tanizaki H. - The Time-Varying Parameter Model Revisited :: Электронная
• Sheffer A., Praun E., Rose K. - Mesh Parameterization Methods and Their

A method for model comparison based on the parameter sensitivity measures Ekaterina Myasnikova Peter the Great St.Petersburg Polytechnical University, 29 Politekhnicheskaya , 195251, St.Petersburg, Russia, e-mail: myasnikova@spbcas.ru Alexander Spirov Sechenov Institute of Evolutionary Physiology and Biochemistry, 44 Toreza, 194223, St. Petersburg, Russia, Computer Science and CEWIT, State University of New York Stony Brook, Stony Brook, NY, USA e-mail: alexander.spirov@gmail.com Introduction. ...

Еще в разделе: (Показать все результаты (>305) - mccmb.belozersky.msu.ru/ )

• http://mccmb.belozersky.msu.ru/2013/abstracts/abstracts/26.pdf
• http://mccmb.belozersky.msu.ru/2015/proceedings/abstracts/136.pdf
• http://mccmb.belozersky.msu.ru/2013/abstracts/abstracts/98.pdf

... Institute Laboratory-Chairs . ... On the other hand, there is an input of a concept of reference system relative motion as invariance breakdown in the intervals of particles motion. ... In pseudo-Euclidean spaces, there is a proved existence of two fundamental types of motion – exterminable, which can be exterminated via matching a reference system, and non-exterminable, which cannot be exterminated via matching a reference system, and which also lays the base for the phenomenon of the course of...

Еще в разделе: (Показать все результаты (>509) - chronos.msu.ru/ )

• Russian Interdisciplinary Temporology Seminar

... A numerical method of parameter reconstruction in the FitzHugh-Nagumo and Aliev-Panfilov models" . Pavelchak I.A. An inverse problem for the FitzHugh-Nagumo and Aliev-Panfilov models describing the wave propagation in excitable media is considered. The problem consists in the reconstruction of model parameters using the measurements performed on the boundary of a plane domain. ... Keywords: FitzHugh-Nagumo and Aliev-Panfilov models, inverse problem, numerical methods . ...

Еще в разделе: (Показать все результаты (>204) - num-meth.srcc.msu.ru/ )

• "Stationary distribution for the Jacobi equation with a large random curvature
• "Influence of genetic algorithm parameters on the docking efficiency with the
• "An algorithm of assigning the force parameters to atoms of organic molecules

... Spectral and kinetic parameters of phosphorescence of triplet chlorophyll a in the photosynthetic apparatus of plants. ... Spectral and kinetic parameters and quantum yield of IR phosphorescence accompanying radiative deactivation of the chlorophyll a (Chl a) triplet state were compared in pigment solutions, greening and mature plant leaves, isolated chloroplasts, and thalluses of macrophytic marine algae. ... This parameter is stable in leaves of different plant species. ...

Еще в разделе: (Показать все результаты (>66) - biochem.bio.msu.ru/ )

... Solar 7Be neutrinos C. Arpesella et al. Borexino Collab.) ... Solar 8B neutrinos Energy spectrum before cosmogenic cut (5 s after each muon): MSW-LMA prediction: expected 8B neutrinos rate in 100 tons fiducial volume of BX scintillator above 2.8 MeV : R(8B) = 0.27 ± 0.03 cpd 2.6 MeV gammas (208Tl) from PMTs and in the buffer Muon cut Measured rate in 100 tons fiducial volume: R(8B) = 0.26 ± 0.04 ± 0.02 cpd FV cut astro-ph arXiv:0808.2868 Ethr= 2.8 MeV 5 distant from the 2.6 ...

Еще в разделе: (Показать все результаты (>223) - nuclphys.sinp.msu.ru/ )

• http://nuclphys.sinp.msu.ru/conf/epp10/Medvedev.pdf
• http://nuclphys.sinp.msu.ru/conf/lpp14/210809/Braguta.pdf
• http://nuclphys.sinp.msu.ru/conf/lpp14/220809/Demidov.pdf

... About lab . ... Online Journal "Computer graphics and multimedia" (in russian) . ... Algorithms for calculating parameters of virtual scenes in computer vision tasks . ...

Еще в разделе: (Показать все результаты (>217) - graphics.cs.msu.ru/ )

• Videocodecs tuning | Graphics and Media Lab
• Videocodecs tuning | Лаборатория компьютерной графики и мультимедиа
• x264 codec improvement | Graphics and Media Lab

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>21) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search

... Among the methods of theoretical investigation of coordination compounds, molecular mechanics seems to be an optimal choice. However, conventional MM force fields typically do lack metal-related force field parameters. ... Let us calculate (MM) energy gradient for experimental structures using purely organic force field with no metal-dependent terms. ... In other words, thus calculated forces give an "imprint" for the derivation of metal-dependent forces. ...

Еще в разделе: (Показать все результаты (>625) - chem.msu.ru/ )

• Comparative Analysis of Intramolecular Parameters of Nitrocompounds:
• Optimization of Optical Scheme Parameters in Dual-Beam Thermal Lens...
• Photoacoustic detection of the parameters of laser vaporisation of amorphous

Next: Items that Define Paths Up: The sendmail.cf File Previous: An Example sendmail.m4 File . A few or the items in the sendmail.m4 file are required all the time; others can be ignored if you can get away with defaults. The following sections describe each of the items in the example sendmail.m4 file in more detail. Items that Define Paths . Defining the Local Mailer . ... Domain Name Service Related Items . Defining Names the Local System is Known by . UUCP-Related Items . ...

Еще в разделе: (Показать все результаты (>205) - itpm.msu.su/ )

• ITPM MSU Web Page
• All About ifconfig
• How to Tell UUCP about other Systems-- the sys File

Welcome , Registration , and other StartingPoints ; TWiki history & Wiki style; All the docs.. ... Line: 1 to 1 . ... Changed: . ... It should correspond to the format of the format parameter. ... Topic:* | ... FAQ\:[\n\r]*([^\n\r]+).*) [[$topic][Answer.. ... SEARCH{ "\.*" scope="topic" regex="on" nosearch="on" nototal="on" order="modified" reverse="on" format="| [[$topic]] | ... SEARCH{ "\.*" scope="topic" type="regex" nosearch="on" nototal="on" order="modified" reverse="on" format="| [[$topic]] | ...

Еще в разделе: (Показать все результаты (>36174) - dualopt1.cmm.msu.ru/ )

• IncludeTopicsAndWebPages - TWiki - TWiki - (printable)
• VarURLPARAM - TWiki - TWiki
• VarURLPARAM - TWiki - TWiki - (printable)

... It was found that CNT-based filters are efficient for the adsorption of heavy metals from aqueous solution. DETERMINATION OF THE NI (Tl) DETECTOR EFFICIENCY USING RADIOACTIVE PARALLELEPIPED SOURCES Mohamed S. Badawi1), Mona M. Gouda1), Ahmed M. El-Khatib1), Mohamed A. Elzaher2), Abouzeid A. Thabet3), Ahmed A. Salim1) and Mahmoud I. Abbas1) 1) Physics Department , Faculty of Science, Alexandria University , 21511 Alexandria, Egypt , 2) Department of Basic and Applied Sciences, ...

Еще в разделе: (Показать все результаты (>115) - danp.sinp.msu.ru/ )

• http://danp.sinp.msu.ru/LIIWM/jap103(2008)07E738.pdf

Preliminary results of astroclimate parameters measurements at the Sternberg 2.5m telescope installation site V.Kornilov, N.Shatsky, S.Potanin, O.Voziakova, B.Safonov Moscow, 2008 Acknowledgements A.Belinskiy M.Kornilov A.Tokovinin M.Kuznetsov P.Kortunov E.Gorbovskoy SAI administration some SAI students Pulkovo solar station (KHSS) staff RFBR support MAVEG Gmbh Why to study optical turbulence and some other relevant ... Mean seeing by DIMM data for this night is 1''5. ...

Еще в разделе: (Показать все результаты (>32) - curl.sai.msu.ru/ )

• . The . MASS . Group .

... In this study we try to answer the question about the possible primary melt for Guli massif, comparing the composition of spinel-group minerals from the dunites of Guli massif with model compositions of spinel-group minerals, which are in equilibrium in system, chemically corresponding with primary melt. We consider three candidates to be a primary melt for Guli massif: meimechite, picrite and khatangite. ... The influence of this factor is strongly limited by the H 2 O solubility in the melt. ...

Еще в разделе: (Показать все результаты (>580) - geo.web.ru/ )

• http://geo.web.ru/conf/alkaline/2009/Nedosekova.htm
• Informal geological society (RSG SG )
• Seismic tomography of central Eurasia