... Length = 194692 Score = 28.2 bits (14), Expect = 1.0 Identities = 14/14 (100%) Strand = Plus / Plus Query: 14 gggattcgaacccc 27 || ... Sbjct: 157615 cccttagcaggggcgcctcttcagcc 157640 Score = 26.3 bits (13), Expect = 4.1 Identities = 13/13 (100%) Strand = Plus / Plus Query: 14 gggattcgaaccc 26 || Sbjct: 158927 gggattcgaaccc 158939 Score = 26.3 bits (13), Expect = 4.1 Identities = 13/13 (100%) Strand = Plus / Plus Query: 14 gggattcgaaccc 26 || ...

Еще в разделе: (Показать все результаты (>2976) - kodomo.cmm.msu.ru/ )

• http://kodomo.cmm.msu.ru/~kut/term3/files/bnresult.txt
• http://kodomo.cmm.msu.ru/~pavel_s/term3/blastn.txt
• http://kodomo.cmm.msu.ru/~golikov_v/practices/aj223173.out

... MG1655, complete genome. (927 letters) Database: pm 204 sequences; 2,269,587 total letters Searching..................................................done Score E Sequences producing significant alignments: (bits) Value AE006203 Pasteurella multocida subsp. multocida str. Pm70 sectio.. ... 28 6.5 AE006163 Pasteurella multocida subsp. multocida str. ... Length = 10697 Score = 30.2 bits (15), Expect = 1.6 Identities = 15/15 (100%) Strand = Plus / Plus Query: 193 cgcatgattctgctt 207 || ...

Еще в разделе: (Показать все результаты (>6521) - kodomo.fbb.msu.ru/ )

• http://kodomo.fbb.msu.ru/~podkovkina/v.txt
• http://kodomo.fbb.msu.ru/~podkovkina/vir.txt
• http://kodomo.fbb.msu.ru/~element/Term3/pm.txt

... Length=2222430 Score = 55.4 bits (60), Expect = 6e-08 Identities = 53/68 (78%), Gaps = 0/68 (0%) Strand=Plus/Plus Query 141 TTACTGGGCGTAAAGCGCACGCAGGCGGTTTGTTAAGTCAGATGTGAAATCCCCGGGCTC 200 || Sbjct 1090874 TTACTGGGCTTAAAGCGCCCGTAGCCGGCCCGGCAAGTCGCTCCTGAAATCCCCGGGCTC 1090933 Query 201 AACCTGGG 208 || ... Sbjct 2071246 AGCCGCGGTAATACGG 2071261 Score = 28.3 bits (30), Expect = 8.9 Identities = 15/15 (100%), Gaps = 0/15 (0%) Strand=Plus/Plus Query 222 ACTGGCAAGCTTGAG 236 || ...

Еще в разделе: (Показать все результаты (>21) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast.out

... Online Services | ... Construct your query and output by sequental openings of needed fields. One output field must be selected (not be blank) at least. ... Query parameters: . Select for output . ... Energy (keV) . ... Y D H M S MS US NS PS FS AS EV KEV MEV or Stable . ... Energy of the ?-ray (keV) . ... Energy parameters of nucleus (B , Alpha energy, N, P separation energy) . ... Neutron separation energy (keV) . Proton separation energy (keV) . ... Excited energy(keV) . ...

Еще в разделе: (Показать все результаты (>7) - cdfe.sinp.msu.ru/ )

... to_tsquery( [ configuration , ] querytext text) RETURNS TSQUERY . ... Query rewriting is a set of functions and operators for tsquery type. ... We'll expand query supernovae using table-driven rewriting rules. =# create table aliases (t tsquery primary key, s tsquery); =# insert into aliases values(to_tsquery('supernovae'), to_tsquery('supernovae|sn')); =# select rewrite(to_tsquery('supernovae'), 'select * from aliases') && to_tsquery('crab'); ?column? --------------------------------- ( 'supernova'...

Еще в разделе: (Показать все результаты (>993) - www.sai.msu.su/ )

• APOD: 2009 September 8 - Unexpected Impact on Jupiter
• APOD: 2008 January 1 - Rays from an Unexpected Aurora
• SAL- Programming - Languages Compilers - Expect

... expect-5.39.0-libdir.patch . 2015-Aug-09 03:38:18 . 0.4K . text/plain . expect-5.43.0-avoid-tcl-internals-1.patch . ... expect-5.43.0-darwin.patch . ... expect-5.43.0-missing-includes.patch . ... expect-5.43.0-multilib.patch . ... expect-5.44.1.15-expectk.patch . ... expect-5.44.1.15-gfbsd.patch . ... expect-5.44.1.15-headers.patch . ... expect-5.44.1.15-ldflags.patch . ... expect-5.44.1.15_with-tk-no.patch . ... expect-5.45-darwin-install_name.patch . ... expect.m4 . ...

Еще в разделе: (Показать все результаты (>12782) - mirror.msu.net/ )

• Index of /pub/gentoo-portage/dev-tcltk/expect/
• Index of /pub/gentoo-portage/dev-python/expects/
• Index of /pub/gentoo-portage/dev-tcltk/expect-lite/

Astronomy Picture of the Day . Unexpected Impact on Jupiter . ... 8.09.2009 . ... First discovered by an amateur astronomer Anthony Wesley on 2009 July 19, the impact was quickly confirmed and even imaged by the Hubble Space Telescope the very next day. ... It is now thought that a small comet -- perhaps less than one kilometer across -- impacted Jupiter on or before 2009 July 19. ... July . ... Publications with keywords: Jupiter - impact . Publications with words: Jupiter - impact . ...

Еще в разделе: (Показать все результаты (>7028) - www.astronet.ru/ )

• An Unexpected Flare from the Crab Nebula
• Moons, Rings, and Unexpected Colors on Saturn
• Rays from an Unexpected Aurora

Электронная библиотека . ... Главная Ex Libris Книги Журналы Статьи Серии Каталог Wanted Загрузка ХудЛит Справка Поиск по индексам Поиск . ... Поиск по указателям . Результат поиска . Книга . Страницы для поиска . ... Электронная библиотека попечительского совета мехмата МГУ , 2004-2016 . ...

Еще в разделе: (Показать все результаты (>3465) - lib.mexmat.ru/ )

• Поиск книг, содержащих Математическое ожидание (expectation или expected value)
• Поиск книг, содержащих 'Математические досуги' (The Unexpected Hanging and
• Rothwell W.J. - What Ceos Expect From Corporate Training :: Электронная

. [ Войти ] . Главная -> Фильмы -> Expecting Love . Пользователи . Демо . Деньги . Фильмы . Форум . Expecting Love . Польша 2008 . отметить . Мелодрама . Комедия .

Еще в разделе: (Показать все результаты (>179) - kinfo.ru/ )

• Tales of the Unexpected - Фильмы - Kinfo.ru
• Expecting - Фильмы - Kinfo.ru
• An Unexpected Love - Фильмы - Kinfo.ru

... Why do I see a string of "X"s (or "N"s) in my query sequence that I did not put there? ... BLAST (Basic Local Alignment Search Tool) is a set of similarity search programs designed to explore all of the available sequence databases regardless of whether the query is protein or DNA. ... Filters are used to remove low-complexity sequence because it can cause artifactual hits (please see Q: After running a search why do I see a string of "X"s (or "N"s) in my query sequence that I did not put there? ...

Еще в разделе: (Показать все результаты (>139) - www.genebee.msu.ru/ )

• GeneBee BLAST 2.2.22+ Services .
• GeneBee BLAST 2.2.22+ Services Help
• GeneBee BLAST 2.2.8 Services Help

... 2000 March 12 . Supernova 1994D and the Unexpected Universe . Credit: High-Z Supernova Search Team , HST , NASA . Explanation: Far away, long ago, a star exploded. ... Supernova 1994D was not of interest for how different it was, but rather for how similar it was to other supernovae . ... The large number and great distances to supernovae measured over the past few years have been interpreted as indicating that we live in a previously unexpected universe . ... About APOD | ...

Еще в разделе: (Показать все результаты (>13) - www.arcetri.astro.it/ )

• APOD: December 30, 1998 - Supernova 1994D and the Unexpected Universe

... Полная версия этой страницы: EXPECT . Студенческий форум Физфака МГУ > Общий > Все обо всем > Цифровые технологии . GLAMURRRRRR . ... есть таккая штука под UNIX называица expeсt...па нему нету вроди как книжек нарускам..вот..может кто подскажет как мона ево асвоить..нада по работе. ivandasch . ... чето такое помню, што пользовался для чего-то им, но не помню... =( врде как автоматизация в шелле работы с телнет и всякими прогами типа консолных... но мож ошибаюсь, знакомо вобщем. man expect . ...

Еще в разделе: (Показать все результаты (>145) - wasp.phys.msu.ru/ )

• EXPECT - Студенческий форум Физфака МГУ

By default a search looks into topic titles, topic texts and form fields in the current web . ... Type the words you want to find . Multiple words are combined: intranet web service returns all pages that have the three words anywhere in the page . Use double quotes for literal search (also known as phrase search) to search the exact words in that exact order, for example "web service" . ... Perhaps your search words are listed in the stop word list and excluded from the results. ...

Еще в разделе: (Показать все результаты (>3956) - wiki.cmc.msu.ru/ )

... Пользователи -General- Common Current University Society Study Diaspora FAQ Real Estate -Technical- Development Hard&Soft Network Mobile -Market- Market Services Job -Hobby- Behemoth Health Love&Sex Еда Media Games Auto&Moto Sport Hobby Flood Zone -Servant- Alternative Forums Forum -Garbage- Revolution Garbage Private . Hobby >> Media >> The Hobbit : An Unexpected Journey . ... The Hobbit : An Unexpected Journey [ re: SuperBizZzon ] . ... Re: The Hobbit : An Unexpected Journey [ re: snowman ] . ...

Еще в разделе: (Показать все результаты (>532) - www.snto-msu.net/ )

• [php] "Unexpected $end" - не могу понять что за ошибка - Public forum of MSU
• wine 1.0 released - Public forum of MSU united student networks

... Пользователи -General- Common Current University Society Study Diaspora FAQ Real Estate -Technical- Development Hard&Soft Network Mobile -Market- Market Services Job -Hobby- Behemoth Health Love&Sex Еда Media Games Auto&Moto Sport Hobby Flood Zone -Servant- Alternative Forums Forum -Garbage- Revolution Garbage Private . Hobby >> Media >> The Hobbit : An Unexpected Journey . ... The Hobbit : An Unexpected Journey [ re: SuperBizZzon ] . ... Re: The Hobbit : An Unexpected Journey [ re: snowman ] . ...

Еще в разделе: (Показать все результаты (>1023) - www.fds-net.ru/ )

Core information (Nucleus, Levels, Gamma transition, Decays, Data type) . ... any adopted (levels and gammas only) experimental . ... Query parameters: . Select for output . ... Levels (E, JPI, T1/2, etc.) ... Energy (keV) . ... Y D H M S MS US NS PS FS AS EV KEV MEV or Stable . ... Energy of the ?-ray (keV) . Relative photon intensity . ... Energy parameters of nucleus (B , Alpha energy, N, P separation energy) . ... Neutron separation energy (keV) . Proton separation energy (keV) . ...

17. Экологический Форум - Фундаментальная Экология: regulate concerns expected and

18. Программирование и решение задач на ЭВМ - Справочник