Network Working Group Request for Comments: 5612 Category: Informational P. Eronen Nokia D. Harrington Huawei Technologies (USA) August 2009 Enterprise Number for Documentation Use Abstract This document describes an Enterprise Number (also known as SMI Network Management Private Enterprise Code) for use in documentation. ... This Enterprise Number is not intended to be implemented. ... Eronen & Harrington Informational [Page 2] RFC 5612 Enterprise Number for Documentation Use August 2009 6. ...

Еще в разделе: (Показать все результаты (>24323) - mirror.msu.net/ )

• http://mirror.msu.net/pub/rfc-editor/rfc-ed-all/pdfrfc/rfc7218.txt.pdf
• http://mirror.msu.net/pub/rfc-editor/rfc-ed-all/rfc7218.txt
• http://mirror.msu.net/pub/rfc-editor/rfc-ed-all/pdfrfc/rfc5737.txt.pdf

Contents] [Previous page] [Next page] Index] . This book describes how to use Dynamic HTML to incorporate style sheets, positioned content, and downloadable fonts in your web pages. ... Introducing Style Sheets . ... Style Sheets in Communicator . Using Cascading Style Sheets to Define Styles . ... Defining Style Sheets with the <STYLE> Tag . Defining Style Sheets in External Files . ... Combining Style Sheets . ... Style Sheets Ink Home Page . ... Positioning HTML Content Using Styles . ...

Еще в разделе: (Показать все результаты (>5444) - crydee.sai.msu.ru/ )

• SGML reference information for HTML
• HTML Document Representation
• About the HTML 4.0 Specification

... LDAP is the Lightweight Directory Access Protocol, and is a protocol used to access "Directory Servers". ... Search surname entry $sr= ldap _ search ($ds, o=My Company, c=US , sn=S* ); echo Search result is .$sr. p ; echo Number of entires returned is . ldap _count_ entries ($ds,$sr). p ; echo Getting entries ... p ; $info = ldap _ get _ entries ($ds, $sr); ... ldap_get_attributes -- Get attributes from a search result entry . ... ldap_get_entries -- Get all result entries...

Еще в разделе: (Показать все результаты (>1785) - oit.cmc.msu.ru/ )

• Duplicating Variable Contents: The Copy Constructor
• Apache module mod_imap
• xml_parse_into_struct

Databases (NSDC) of the Natural Planetary Satellites. ... NSDC: Database of astrometric observations of Natural Planetary Satellites . ... They are thoroughly looking for observations in different sources, creating their owndatabases which are then mostly inaccessible to other researchers. ... In the file "content" with explications, the reference is given to the data source as well as the bibliographic reference. ... Data sources. ... Why a specific bibliographic database for Natural satellites? ...

Еще в разделе: (Показать все результаты (>409) - lnfm1.sai.msu.ru/ )

Hide Zen home . ... Extent is a shortest and non-nested sequence of words, which satisfy a query . ... We don't consider normalization of document weight to 1, since we have no global information about document collection. w{i}, len{i} - weight and length of i-th extent . ... Next - the number of unique extents. freq{i} - frequency of i-th extent . We could consider strict and soft uniqueness of an extent, depending on how do we consider the order of words in extent. ... 2 - document length . ...

Еще в разделе: (Показать все результаты (>5447) - www.sai.msu.su/ )

• The Network Time Protocol (NTP) Distribution
• Zen: Tsearch V2 Readme
• Zen: sncat design

... Line: 1 to 1 . Welcome to TWiki, a web-based collaboration tool, document management tool, and knowledge base tool. ... Changed: . Complete documentation for Webmasters, system administrators, anyone interested in installing and fine-tuning a TWiki site. ... TWikiVariables . ... A collection of single-page topics: clear, concise how-to guides designed for busy TWiki users. ... TWikiVariables : Manipulate text, graphics, calculations, and more with simple expanding text strings. ...

Еще в разделе: (Показать все результаты (>42744) - dualopt1.cmm.msu.ru/ )

• %TOPICTITLE% (14 vs. 18) - TWiki
• FileAttachment - TWiki - TWiki
• %TOPICTITLE% (13 vs. 14) - TWiki

... Sample SGML catalog . The following sections contain the formal SGML definition of HTML 4.0, including the SGML declaration and the Document Type Definition (DTD), as well as a sample SGML catalog . ... The following sample SGML catalog can be used with an SGML parser, such as nsgmls (see [SP] ), to verify that HTML documents conform to the HTML 4.0 DTD. ... This is because an SGML parser relies solely on the given SGML DTD which does not express all aspects of a valid HTML 4.0 document. ...

Еще в разделе: (Показать все результаты (>713) - itpm.msu.su/ )

• Definitions and Conventions
• About the HTML 4.0 Specification
• mod_imap - Apache HTTP Server

... Reference Document on Best Available Techniques for Management of Tailings and West-Rock in Mining Activities . ... Название: Reference Document on Best Available Techniques for Management of Tailings and West-Rock in Mining Activities . ...

Еще в разделе: (Показать все результаты (>20623) - lib.mexmat.ru/ )

• Ray E. - Learning XML :: Электронная библиотека попечительского совета мехмата
• Cabrera l.-F., Kurt C. - Web Services Architecture and Its Specifications:
• Holzner S. - Spring Into PHP 5 :: Электронная библиотека попечительского совета

... HTML as an Application of SGML . ... HTML Public Text Identifiers . ... HTML as an Internet Media Type . text/html media type . ... Undeclared Markup Error Handling . ... Input Field: INPUT . Text Field: INPUT TYPE=TEXT . Password Field: INPUT TYPE=PASSWORD . Check Box: INPUT TYPE=CHECKBOX . Radio Button: INPUT TYPE=RADIO . Image Pixel: INPUT TYPE=IMAGE . Hidden Field: INPUT TYPE=HIDDEN . Submit Button: INPUT TYPE=SUBMIT . Reset Button: INPUT TYPE=RESET . ...

Еще в разделе: (Показать все результаты (>586) - comet.sai.msu.ru/ )

• Understanding HTML and SGML
• References
• The Structure of HTML 3.0 Documents

... Alphabetical Class List . ... OpenGL 3D Graphics Support . Netscape/Explorer Plugin Support . ... Troll Tech Contact Information . ... It is a product of Troll Tech . ... Qt Professional Edition is provided for commercial software development. It is provided with upgrades and technical support. ... Qt Free Edition is the Unix/X11 version of Qt available for development of free software only. It is provided free of charge under the Qt Free Edition License . ... Copyright © 1998 Troll Tech . ...

Еще в разделе: (Показать все результаты (>733) - rtm-cs.sinp.msu.ru/ )

• Qt Toolkit - QAccel Class
• Qt Toolkit - QBitmap Class
• Qt Toolkit - QButtonGroup Class

Modules | ... Apache HTTP Server Version 2.0 . Apache > HTTP Server > Documentation > Version 2.0 . This document supplements the mod_rewrite reference documentation . ... Introduction . ... Rewrite Flags . ... The Apache module mod_rewrite is a very powerful and sophisticated module which provides a way to do URL manipulations. ... SCRIPT_NAME=/sw/lib/w3s/tree/global/u/rse/.www/index.html SCRIPT_FILENAME=/u/rse/.www/index.html SCRIPT_URL=/u/rse/ SCRIPT_URI=http://en1.engelschall.com/u/rse/ . ...

Еще в разделе: (Показать все результаты (>1239) - uneex.lorien.cs.msu.su/ )

• mod_imap - Apache HTTP Server
• HelpOnParsers/ReStructuredText - UNИX
• HOWTOs

... О UNИX . ... ReStructuredText . ... The Parser in MoinMoin . ... Support for MoinMoin-specific link schemes . ... Before you can use it, you need to install the Python docutils package, which provides the additional Re Structured Text support that MoinMoin needs. ... rst Here is a link to a page attachment__. __ attachment:Attachment.zip }}} . ... If the attachment for the page does not exist, the link text will be replaced with the typical MoinMoin replacement text for uploading an attachment. ...

Еще в разделе: (Показать все результаты (>388) - uneex.mithril.cs.msu.su/ )

• HelpOnParsers/ReStructuredText/RstPrimer - UNИX

... Application Developer Topics . ... Related Topics . Topics for normal users that want to develop Foswiki applications. ... Skin templates are used when composing the output from all actions, such as view, edit, and preview. ... Foswiki Javascript support comprises a number of base Javascript files, attached to this topic, that provide support for features in the basic screens, and are used by most skins. ... This topic: System > WebHome > ReferenceManual > DeveloperDocumentationCategory . ...

Еще в разделе: (Показать все результаты (>11111) - wiki.cmc.msu.ru/ )

• (backlinks in all Webs) TemplateTopics < System < Foswiki
• (backlinks in System Web) TemplateTopics < System < Foswiki
• MainFeatures < System < Foswiki

... Next message: [RU-NGI] обучалки по Грид . ... You have been assigned Ticket # 2832 https ://glse.itep.ru/adminsupport/supporter/alex.php?t=tupd id= 2832 User(login): Malgorzata Krakowian Short Description: ROC Russia - January 2015 - RP/RC OLA performance Description: Dear NGI, According ... reports for Resource infrastructure Provider [1] and Resource Center[2] OLA for '''January '''following problems occurred: Report: https :// ... More information about the RU-NGI mailing list . ...

Еще в разделе: (Показать все результаты (>14898) - theory.sinp.msu.ru/ )

• [RU-NGI] Fwd: Fwd: NOTIFICATION on GGUS-Ticket-ID: # 114235 "ASSIGNED"
• [RU-NGI] Fwd: NOTIFICATION on GGUS-Ticket-ID: # 114235 "ASSIGNED" "ROC_Russia"
• Structure of LanHEP input file

Backlinks to TemplateTopics in System Web ( Search all webs ) . ... Related topics: CommentPluginTemplates, .CommentPluginExamples .. NEW - 10 Apr 2011 - 18:03 by ProjectContributor . ... NEW - 03 Aug 2010 - 16:42 by ProjectContributor . ... Developer Documentation Application Developer Topics Topics for normal users that want to develop Foswiki applications. ... TemplateTopics has more) . ... NEW - 03 Sep 2010 - 08:51 by ProjectContributor . ... NEW - 05 Nov 2010 - 13:09 by ProjectContributor . ...

Еще в разделе: (Показать все результаты (>7452) - wiki.cs.msu.ru/ )

• (backlinks in all Webs) TemplateTopics < System < Foswiki
• FileAttachment < System < Foswiki
• (backlinks in all Webs) DataForms < System < Foswiki

This module provides for server-side imagemap processing. ... Configurable generation of imagemap menus. The lines in the imagemap files can have one of several formats: directive value [x,y ...] . ... The directives can come in any order, but are processed in the order they are found in the imagemap file. base Directive . ... Module: mod_imap . ... Its value is overridden by a default directive within the imagemap file. ... Its value is overridden by a base directive within the imagemap file. ...

Еще в разделе: (Показать все результаты (>124) - neptun.sai.msu.ru/ )

• Apache module mod_log_referer
• Apache module mod_negotiation
• Apache module mod_include

... MPI: A Message-Passing Interface Standard . ... The Message Passing Interface Forum (MPIF), with participation from over 40 organizations, has been meeting since January 1993 to discuss and define a set of library interface standards for message passing. ... The goal of the Message Passing Interface, simply stated, is to develop a widely used standard for writing message-passing programs. ... Index to MPI Standard . ... Marc Snir, William Gropp, Ewing Lusk, Point-to-Point Communications . ... Центры...

Еще в разделе: (Показать все результаты (>571) - www.parallel.ru/ )

• Example using MPI_BCAST | PARALLEL.RU - Информационно-аналитический центр по
• Organization of this Document | PARALLEL.RU - Информационно-аналитический центр
• Attributes Example | PARALLEL.RU - Информационно-аналитический центр по

news ]] . ... Highlight news: CompHEP is in the top rating list on The OpenScience Project . ... 16/03/2009 New official version of CompHEP (4.5.1) is available. ... 14/11/2006 Two new versions of CompHEP-PYTHIA interface (cpyth-1.2.7 and cpyth-2.0.4) are available. ... 13/09/2006 A new version of CompHEP-PYTHIA interface and a new interface CompHEP-HERWIG has been released. ... 01/07/2006 Talk on new physics with CompHEP by M.Dubinin at Tools for SUSY and the New Physics (LAPP, 26-28 June 2006). ...

Еще в разделе: (Показать все результаты (>90) - comphep.sinp.msu.ru/ )

• download:main [CompHEP]
• extra:main [CompHEP]

... 7 (495) 939-16-82 info@physics.msu.ru . ... Contacts . ... Research Centers . ... Research . ... Education research . ... Research Highlights of the Year . Research Highlights Archive . ... 16.05.2003 Prof. Oleg Rudenko, head of the Chair of Acoustics, has bee assigned the vice-chair of the Council for the Russian Foundation of Basic Research. ... 7 495 939-16-82, . Fax: +7 495 932-88-20, . ...

Еще в разделе: (Показать все результаты (>386) - phys.msu.ru/ )

... Alignment Sequence . Include picture . No Picture Only Structure Structure and BP numbers Structure and Stem Energy Full Picture . Sequence name . Alignment OR sequence (without name). The usage of Alignment is strongly recommended. Alignment example: . ... ANMF CGCGGGGTAGAGCAGCCTGGTAGCTCGTCGGGCTCATA AQTRNF GCC-AGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAA BGTRF GCC-AGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAT ANMF ATCCTCTCCCCGCC---- AQTRNF ATCCGCCTCCCGGCACCA BGTRF ATCCGCCTCCCGGCACCA . ...

Еще в разделе: (Показать все результаты (>249) - www.genebee.msu.ru/ )

• Screening pattern or alignmemt against PROTEIN databank
• Screening of pattern or alignment against PROTEIN databank
• Screening protein sequence against PROSITE databank