VerGO . VerGO is a package designed for the global optimization of a real valued function of many variables. ... The present version number is 0.5.3 which indicates several things: First, the code is not complete. ... At present, this research is looking for researchers who are interested in testing this code to help further develop it into a solid package for verified global optimization. ... Source Code Availability: . ... None . ... User Comments: . ... SAL Home | Numerical Analysis | ...

Еще в разделе: (Показать все результаты (>3386) - www.sai.msu.su/ )

• SAL- Numerical Analysis - Optimization - IMPS
• SAL- Numerical Analysis - Misc - GSL
• SAL- Numerical Analysis - Optimization - NP-Completeness

Meles leucurus (Carnivora: Mammalia) identified by mitochondrial DNA cytochrome b . Two sympatric phylogroups of the Asian badger Meles leucurus (Carnivora: Mammalia) identified by mitochondrial DNA cytochrome b gene sequences . ... Evolution of the cytochrome b gene of mammals // Journal of Molecular Evolution. ... Low genetic diversity in Japanese populations of the Eurasian badger Meles meles (Mustelidae, Carnivora) revealed by mitochondrial cytochrome b gene sequences // Zoological Science. ...

Еще в разделе: (Показать все результаты (>1610) - zmmu.msu.ru/ )

• A preliminary study on molecular phylogeny of giant flying squirrels, genus
• A preliminary study on genetic divergence of the Asian lesser white-toothed
• Russian Journal of Theriology

... Doyle J.F. - Modern experimental stress analysis : completing the solution of partially specified problems . ... Название: Modern experimental stress analysis : completing the solution of partially specified problems . Автор: Doyle J.F. Аннотация: . ... Its central concern is to establish formal methods for including measurements as part of the complete analysis of such problems by presenting a new approach to the processing of experimental data and thus to experimentation itself. ...

Еще в разделе: (Показать все результаты (>21916) - lib.mexmat.ru/ )

• Bousfield A., Kan D. - Homotopy limits, completions and localizations ::
• Robinson A. - Complete theories :: Электронная библиотека попечительского
• Flajolet P., Gourdon X., Panario D. - The complete analysis of a polynomial

... About lab . ... Video processing . ... Video-based tracking . ... Online Journal "Computer graphics and multimedia" (in russian) . ... MSU Codec Comparison aims to deliver high quality comparisons of video encoders to both industrial and scientific communities. ... Selected projects of Graphics & Media Lab - best publications and most prominent results. ... Video matting refers to a problem of accurate decomposition of given video sequence to background layer, foreground layer and transparency map. ...

Еще в разделе: (Показать все результаты (>309) - graphics.cs.msu.ru/ )

• Selected completed projects | Graphics and Media Lab
• Video-based tracking | Graphics and Media Lab
• Video processing | Graphics and Media Lab

NPG-explorer : a new tool for nucleotide pangenome construction and closely related prokaryotic genomes analysis Boris Nagaev2, Maxim Nikolaev2, Andrei Alexeevski 1 1,2,3* A.N.Belozersky Institute Of Physico-Chemical Biology and 2Faculty ... @gmail.com Moscow State University, Moscow 119991, Russia 3Scientific Research Institute of System Analysis (NIISI RAS), Moscow Genomes of closely related bacteria have highly similar sequences of orthologous ... Blocks are classified into four categories. ...

Еще в разделе: (Показать все результаты (>371) - mccmb.belozersky.msu.ru/ )

• http://mccmb.belozersky.msu.ru/2013/abstracts/abstracts/38.pdf
• http://mccmb.belozersky.msu.ru/2015/proceedings/abstracts/37.pdf
• http://mccmb.belozersky.msu.ru/2015/proceedings/abstracts/143.pdf

Nucleotide sequence of the bioH gene of Escherichia coli" . ... The complete genome sequence of Escherichia coli K-12' . ... The 4,639,221-base pair sequence of Escherichia coli K-12 is presented. ... Highly accurate genome sequences of Escherichia coli K-12 strains MG1655 and W3110' . ... With the goal of solving the whole-cell problem with Escherichia coli K-12 as a model cell, highly accurate genomes were determined for two closely related K-12 strains, MG1655 and W3110. ...

Еще в разделе: (Показать все результаты (>4552) - kodomo.cmm.msu.ru/ )

• Result summary blast-20091031-1941229237

... Results . ... The main results of 2004 were the comparative analysis of genetic diversity of populations of saiga (Saiga tatarica). ... Molecular-genetic diversity and phylogeographic structure of moose population (Alces alces) in the different regions of European part of Russia and Ural were also studied. ... This testifies enough lengthy migrations of moose within the studied region and genetic unity of moose of Europe and Ural. ... Low genetic diversity of this species was determined. ...

Еще в разделе: (Показать все результаты (>4884) - www.sevin.ru/ )

• Экологический Форум - Фундаментальная Экология: i just completed a whole
• Экологический Форум - Фундаментальная Экология: Over virtually the complete
• Laboratories: Molecular Diagnostics Methods Room: Goals and Tasks

Brain Research Group >> Research >> Change-point analysis ... << previous next >> . ... Unless in many other approaches to the analysis of different signal coupling, the information entering the analysis of synchronization in our approach is explicitly represented in the form of elementary, instantaneous events (the change-points). ... Hence the use of correlation/coherency estimates in parallel with change-point analysis seems to be quite rational. ...

Еще в разделе: (Показать все результаты (>73) - brain.bio.msu.ru/ )

• Analysis of change-point synchronization in multi-channel EEG
• Change-points in EEG components with different pattern
• Change-point detection algorithm performance with real EEG

... Numeration assumed . For this study 36 PDB-entries containing coordinates of Homeodomains were used. ... Yes . ... Drosophila melanogaster . ... X-RAY . ... MAT a 1 . ... 182 . ... 151 . ... X-ray . ... According to the gaps present in the alignment, all chains were renumbered so that after each gap the numeration begins from a new number. Thus, all aligned residues of different structures go under the same number and the gaps in the alignment do not put the numeration out. ...

Еще в разделе: (Показать все результаты (>1299) - monkey.belozersky.msu.ru/ )

• About this project
• Molecular biology databases
• ETS numeration assumed

A Pleistocene Climatic Record on the Basis of a Complete Loess-Paleosol Sequence in Central China . ... A complete climatic signal in the loess plateau of Central China was obtained by combining the loess-paleosol record from soil unit S0 until S15 of the Huangling section with that from unit S9 until loess unit L36 of the Jiacun section near Baoji. ... This suggests that the climatic signal retrieved from the soil-paleosol sequence in Central China reflects global long term climatic changes. ...

Еще в разделе: (Показать все результаты (>178) - www.fadr.msu.ru/ )

• THE POST-SIMPOSIUM EXCURSION (July 31 - August 7,1998)
• Untitled
• Online Registration

Выберите категорию обращения: Общие вопросы Отчеты Рейтинги Диссертационные советы Конкурсы Ввод данных Структура организаций Пользователи Проблемы с регистрацией\входом в систему . ... Войти в систему . ... 2015 Analysis of the complete genome sequences of new isolates of the genetically diverse Winona strain of Plum pox virus (PPV W) and the first definitive evidence of intra-strain recombination events . ... 2012 Occurence and genetic diversity of Winona-like Plum pox virus isolates in Russia . ...

Еще в разделе: (Показать все результаты (>4812) - istina.msu.ru/ )

• Beletskii A.B. - сотрудник | ИСТИНА - Интеллектуальная Система Тематического
• Phytopathology - журнал | ИСТИНА - Интеллектуальная Система Тематического
• Bonch-Osmolovskaya E.A. - сотрудник | ИСТИНА - Интеллектуальная Система

... Первая страница Назад Продолжить Последняя страница Обзор Изображения . Публикации с ключевыми словами: Галактика - звездная астрономия . Публикации со словами: Галактика - звездная астрономия . ... Дальний рукав в 3 кпк от центра . Лекции по Галактической Астрономии. ... Стрелец A*: быстрые звезды вблизи центра Галактики . ... KINO.RU - фильмы, кино театры, кино, расписание кино в г. Москва | ... Дизайн квартир и дизайн интерьера . ... Нужно рекламное агентство? ...

Еще в разделе: (Показать все результаты (>9475) - www.astronet.ru/ )

• A Complete Solar Cycle from SOHO
• A Complete Aurora
• Journal "Peremennye Zvezdy"

... 6 import sequence . ... 19 * self.alignment -- alignment object, which the block belongs to . ... 22 * self.positions -- list of positions of the alignment.body that . ... 34 def __init__ ( self , alignment , sequences = None , positions = None ): . ... sequences : . ... 75 If more than one pdb chain for some sequence provided, consider all of them . ... 129 alignment_sequence = self . ... 130 return ( alignment_sequence [ i ] for i in self . ... 132 def ca_atoms ( self , sequence , pdb_chain ): . ...

Еще в разделе: (Показать все результаты (>33222) - kodomo.fbb.msu.ru/ )

• allpy: 56bea23d3c73 lib/block.py
• allpy: 1e5116ce9d75 allpy/block.py
• allpy: 40c086a41ca0 allpy/block.py

... Class Member Functions for MPI . ... Besides the member functions which constitute the C++ language bindings for MPI, the C++ language interface has additional functions (as required by the C++ language). ... The complete set of C++ language bindings for MPI-1 is presented in Annex MPI-1 C++ Language Binding . ... Except where indicated, all non-static member functions (except for constructors and the assignment operator) of MPI member classes are virtual functions. ... Центры . ...

Еще в разделе: (Показать все результаты (>472) - www.parallel.ru/ )

• Progress | PARALLEL.RU - Информационно-аналитический центр по параллельным
• Overview | PARALLEL.RU - Информационно-аналитический центр по параллельным
• General Active Target Synchronization | PARALLEL.RU -

... Protein sequences: . ... OWL : non-redundant database assembled from a number of primary sources including translations of nucleic acid sequences (Swissprot, PIR, NRL3-D and GenPept). ... Database of protein families and HMMs (collection of multiple sequence alignments and hidden Markov models) . ... Collection of protein families constructed by clustering all complete protein sequences in SwissProt. ... The Genome Sequence Database: complete relational database of DNA sequences and annotation . ...

Еще в разделе: (Показать все результаты (>269) - www.genebee.msu.ru/ )

• Fasta3 help
• Bioinformatics portal, Moscow State University
• BioSystems, 30 (1993) 57-63 57

Next: The Present Situation in Up: No Title Previous: Case A: . Why it is possible that the Oppenheimer-Volkoff limit exceeds ? ... The lifetime of HSP (``hot'' spinar) is completely determined by the cooling time which is of the order of s according to different calculations. ... It seems very attractive to identify this cooling time with the mean characteristic gamma-ray burst duration s! . ... Finally, for the high Oppenheimer-Volkoff limit for the cool non-rotating object, when . ...

Еще в разделе: (Показать все результаты (>435) - xray.sai.msu.ru/ )

• Evolutionary Tracks
• Seminars

... Loskutov, and E. V. Ryadchenko Presented by Academician A.R. Khokhlov April 22, 2005 Received April 26, 2005 The problem of the identification and biological significance of chromosome fragments and complete genomes is approached on the basis of the representation of a sequence of DNA nucleotides as a two-dimensional walk. ... However, as applied to DNA, functional and structural fragments of a chromosome may be distinguished by a typical walk "pattern" only for a sufficiently large number of units....

Еще в разделе: (Показать все результаты (>77) - chaos.phys.msu.ru/ )

Filename completion is only available if the the environment variables EDITOR and/or VISUAL are set to either emacs , gmacs or vi . For example: EDITOR=emacs . ... To complete a file or directory name with emacs or gmacs set press the ESC key twice. ls -l on<ESC><ESC> line_help . If the filename is not completed enter more characters until the filename can be uniquely identified. ... To complete a file or directory name with vi set press the \ (backward slash) key. ls -l on\ line_help . ...

Еще в разделе: (Показать все результаты (>159) - comet.sai.msu.ru/ )

• Filename completion
• Filename completion with the C shell
• Filename completion with the Bourne Again SHell

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>29) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/fasta.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out

Kiew Mission - Exit ------------------------------- [Text supplied by Edgar Froese ] ( Froese says words in parenthesis are not spoken but are conducive to elucidation ) Continent Asia Africa Europe Australia America (this is the) Earth Past Present Future World (that is) Peace To understand (uncompleted) To understand (completed) To ask To answer To speak To be absorbed in thought The ...

Еще в разделе: (Показать все результаты (>2509) - crydee.sai.msu.ru/ )

• http://crydee.sai.msu.ru/public/lyrics/cs-uwp/t/tangerine.dream/kiew_mission1
• Historical Notes
• Control statements