Электронная библиотека . ... Главная Ex Libris Книги Журналы Статьи Серии Каталог Wanted Загрузка ХудЛит Справка Поиск по индексам Поиск . ... Поиск по указателям . Результат поиска . Книга . Страницы для поиска . ... Электронная библиотека попечительского совета мехмата МГУ , 2004-2016 . ...

Еще в разделе: (Показать все результаты (>14869) - lib.mexmat.ru/ )

• Gorchels L. - The Product Manager's Handbook: The Complete Product Management
• Niederreiter H. - Random number generation and quasi-Monte Carlo methods ::
• Hinman P.G. - Fundamentals of Mathematical Logic :: Электронная библиотека

... Length = 194692 Score = 28.2 bits (14), Expect = 1.0 Identities = 14/14 (100%) Strand = Plus / Plus Query: 14 gggattcgaacccc 27 || ... Sbjct: 157615 cccttagcaggggcgcctcttcagcc 157640 Score = 26.3 bits (13), Expect = 4.1 Identities = 13/13 (100%) Strand = Plus / Plus Query: 14 gggattcgaaccc 26 || Sbjct: 158927 gggattcgaaccc 158939 Score = 26.3 bits (13), Expect = 4.1 Identities = 13/13 (100%) Strand = Plus / Plus Query: 14 gggattcgaaccc 26 || ...

Еще в разделе: (Показать все результаты (>3105) - kodomo.cmm.msu.ru/ )

• http://kodomo.cmm.msu.ru/~vanilin/3_1/tRNA_blastn.txt
• http://kodomo.cmm.msu.ru/~dragon98/term3/files/blasn.out
• http://kodomo.cmm.msu.ru/~phoenix/term3/resultblastn2.txt

A completely new possibility of Fortran 90 is recursion. Note that it requires that you give a new property RESULT for the output variable in the function declaration. ... Here follows two examples, first recursive calculation of the factorial, then recursive calculations of the Fibonacci-numbers. ... The listings of the routines follow, the output variables are called FAC_RESULT and FIBO_RESULT , respectively. ... Not only functions but also subroutines can be recursive. ...

Еще в разделе: (Показать все результаты (>16060) - crydee.sai.msu.ru/ )

... MG1655, complete genome. (927 letters) Database: pm 204 sequences; 2,269,587 total letters Searching..................................................done Score E Sequences producing significant alignments: (bits) Value AE006203 Pasteurella multocida subsp. multocida str. Pm70 sectio.. ... 28 6.5 AE006163 Pasteurella multocida subsp. multocida str. ... Length = 10697 Score = 30.2 bits (15), Expect = 1.6 Identities = 15/15 (100%) Strand = Plus / Plus Query: 193 cgcatgattctgctt 207 || ...

Еще в разделе: (Показать все результаты (>10243) - kodomo.fbb.msu.ru/ )

• http://kodomo.fbb.msu.ru/~element/Term3/pm.txt
• http://kodomo.fbb.msu.ru/~element/Term3/search_3T.txt
• allpy: 40c086a41ca0 .hgignore

... According to Formal-Logical Approach to Organic Reactions, the systematical search for new, unprecedented types of chemical interconversions needs the complete sets of symbolic, reaction, structural, and skeletal equations to be generated. ... The basic ideas of the effective generating algorithms, some results of the corresponding analytical enumeration techniques, and several new reaction types found by computer programs, are also discussed. ...

Еще в разделе: (Показать все результаты (>683) - chem.msu.ru/ )

• Similarity and difference of exciplexes with complete and partial electron

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>12) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/megablast.out

... You buy Gucci shades from the company store in the us. There are a total of 7 Gucci stores in different metropolitan areas like Honolulu, Hawaii, Boston. Or if you?re planning an overseas trip to Europe and then sure you visit part of the Gucci retail stores. One can find the brand stores in Florence, . ... These stores offer complete and original associated with designer Gucci Sunglasses and associated accents. ... One should be careful not purchaser gucci Fake. ... 2016 С Днем Победы! ...

Еще в разделе: (Показать все результаты (>313) - elana.sinp.msu.ru/ )

• editor | С Днем Победы!
• Наши ветераны | С Днем Победы!
• michael kors outlet uk This makes a rather convincing case for the

-completion-r1 elisp-common DESCRIPTION= Stores, retrieves, generates, and synchronizes passwords securely using gpg, pwgen, and git HOMEPAGE= http://www.passwordstore.org/ SRC _URI= http:// git .zx2c4.com/password-store/snapshot/password-store-${PV}.tar.xz SLOT= 0 LICENSE= GPL-2 KEYWORDS= ~amd64 ~x86 ~x86-macos IUSE= + git X zsh-completion fish-completion emacs dmenu ...

Еще в разделе: (Показать все результаты (>18838) - mirror.msu.net/ )

• http://mirror.msu.net/pub/gentoo-portage/app-admin/pass/pass-9999.ebuild
• http://mirror.msu.net/pub/slackware-current/slackware/d/yasm-1.3.0-i486-1.txt
• Index of /pub/gentoo-portage/app-shells/bash-completion/

... Clarification of MPI_FINALIZE . ... Each process must call MPI_FINALIZE before it exits. ... MPI_FINALIZE is collective on MPI_COMM_WORLD. ... Although it is not required that all processes return from MPI_FINALIZE, it is required that at least process 0 in MPI_COMM_WORLD return, so that users can know that the MPI portion of the computation is over. In addition, in a POSIX environment, they may desire to supply an exit code for each process that returns from MPI_FINALIZE. ... Центры . ...

Еще в разделе: (Показать все результаты (>660) - www.parallel.ru/ )

• Progress | PARALLEL.RU - Информационно-аналитический центр по параллельным
• Client/Server Examples | PARALLEL.RU - Информационно-аналитический центр по
• Semantic Terms | PARALLEL.RU - Информационно-аналитический центр по

Filename completion is only available if the the environment variables EDITOR and/or VISUAL are set to either emacs , gmacs or vi . For example: EDITOR=emacs . ... To complete a file or directory name with emacs or gmacs set press the ESC key twice. ls -l on<ESC><ESC> line_help . If the filename is not completed enter more characters until the filename can be uniquely identified. ... To complete a file or directory name with vi set press the \ (backward slash) key. ls -l on\ line_help . ...

Еще в разделе: (Показать все результаты (>98) - comet.sai.msu.ru/ )

• Filename completion
• Filename completion with the C shell
• Filename completion with the TC shell

The mass terms for fermions in the electroweak theory are generated via their invariant Yukawa interaction with Higgs doublet. ... produces the mass terms for doublet components . which are accompanied by vertices of interactions of fermions with Goldstone fields: . ... Such terms form two mass matrices: one for upper and another for lower fermions. ... Generally the Lagrangian is written down in terms of fermion fields which directly correspond to particles. ...

Еще в разделе: (Показать все результаты (>1291) - theory.sinp.msu.ru/ )

• [Comphep-common] Re: $COMPHEP/genEvents
• [Comphep-common] Events to produce of LHAEF format
• [RU-NGI] Fwd: [LCG-ROLLOUT] [EGI BROADCAST] Decommission of gridops.org

Клуб выпускников МГУ (Московский Государственный Университет) . ... Resvinatrol Complete - на данный момент, первая добавка на рынке, которая использует благоприятное воздействие антиоксиданта ресвератрола, обнаруженного в красном вине, на сердце и замедление процесса старения. Ресвератрол, всего один из сильных антиоксидантов, входящих в состав добавки Resvinatrol Complete. ... Комбинация антиоксидантов Resvinatrol Complete не имеет себе равных на современном рынке антиоксидантной продукции'. ...

Еще в разделе: (Показать все результаты (>334) - www.moscowuniversityclub.ru/ )

• Клуб выпускников МГУ: Обсуждение материала "Таблетки замедляющие процесс

This module is contained in the mod_dir.c file, and is compiled in by default. It provides for "trailing slash" redirects and serving directory index files. ... A file written by the user, typically called index.html . The DirectoryIndex directive sets the name of this file. This is controlled by mod_dir . ... Example: DirectoryIndex index.html then a request for http://myserver/docs/ would return http://myserver/docs/index.html if it exists, or would list the directory if it did not. ...

Еще в разделе: (Показать все результаты (>705) - rtm-cs.sinp.msu.ru/ )

• Qt Toolkit - QNPStream Class
• Qt Toolkit - application/application.cpp example file
• Qt Toolkit - QNPStream member list

This module provides for "trailing slash" redirects and serving directory index files. ... A file written by the user, typically called index.html . ... A "trailing slash" redirect is issued when the server receives a request for a URL http://servername/foo/dirname where dirname is a directory. ... Module: mod_dir . ... Example: DirectoryIndex index.html then a request for http://myserver/docs/ would return http://myserver/docs/index.html if it exists, or would list the directory if it did not. ...

Еще в разделе: (Показать все результаты (>64) - neptun.sai.msu.ru/ )

• Apache modules

... About lab . ... Selected publications . ... Projects . ... Medical image analysis . ... Selected completed projects . Text recognition . Geometric image parsing . Multiple object detection . ... Old projects . ... Online Journal "Computer graphics and multimedia" (in russian) . ... Text detection and recognition in natural images . ... 1) Automatic detection and understanding the text in natural images, such as photographs of city outdoors or building indoors, is a challenging problem. ...

Еще в разделе: (Показать все результаты (>122) - graphics.cs.msu.ru/ )

• Automatic building texture completion | Graphics and Media Lab
• Automatic building texture completion | Лаборатория компьютерной графики и
• The Microsoft Machine Learning and Intelligence School will take place in Saint

Software on Data Processing . We Offer Statistical Software And . Software On Data Analysis And Processing. ... The package is intended for those, who doesn't have large experience in statistical analysis, but needs a quick and convenient data processing tool. ... Package provides full complex of registration and analysis methods, individual EKG monitor-analyzer, special tools for complete polygraph analysis. price: 700$ - 2200$. phone number (095) 437-3695, 155-1365 . ... InCo . ...

Еще в разделе: (Показать все результаты (>4) - statsoft.msu.ru/ )

... Faculty of Physics . ... Research Centers . ... Second harmonic generation in metamaterials with magnetodipole resonance . ... In the research performed by collaboration of scientists from Laboratoire d'Optique Appliqu?e (France), Centro Ricerche Frascati (Italy), and Faculty of Physics of M.V. Lomonosov Moscow State University was for the first time made the detailed experimental study of completely isolated low-order harmonics obtained with interferential filtering from the wide harmonic spectrum....

Еще в разделе: (Показать все результаты (>120) - phys.msu.ru/ )

. [ Войти ] . Главная -> Фильмы -> The Completely Mental Misadv.. Пользователи . Демо . Деньги . Фильмы . Форум . The Completely Mental Misadventures of Ed Grimley . США 1988 . отметить . Сериал . Мультфильм . Комедия . Семейный .

Еще в разделе: (Показать все результаты (>348) - kinfo.ru/ )

• Complete Savages - Фильмы - Kinfo.ru
• Lego Star Wars: The Complete.. - Фильмы - Kinfo.ru
• A Complete History of My Sex.. - Фильмы - Kinfo.ru

... A Complete Solar Cycle from SOHO . ... Credit Copyright: SOHO - EIT Consortium , ESA , NASA Explanation: Every eleven years, our Sun goes through a solar cycle. ... A solar cycle is caused by the changing magnetic field of the Sun, and varies from solar maximum , when sunspot , coronal mass ejection , and flare phenomena are most frequent, to solar minimum, when such activity is relatively infrequent. ... Publications with words: solar cycle - solar maximum - SOHO . ... A Solar Prominence from SOHO ...

Еще в разделе: (Показать все результаты (>4851) - www.astronet.ru/ )

• A Complete Aurora
• Астронет > A Complete Aurora
• Астронет > A Complete Solar Cycle from SOHO

... About Conference . ... Bookstall . All books . Books by MCE participants . ... Password: . ... Approximate price in Conference bookstall 200 roubles. You need to submit Conference application first to order books to Conference bookstall. If you have already registered just enter your username and password. ... 2004 Designed by Lyceum of Informational Technologies ?1533 . ...

Еще в разделе: (Показать все результаты (>130) - www.mce.biophys.msu.ru/ )