... About lab . ... Selected publications . Publications . ... Conference "GraphiCon" . Online Journal "Computer graphics and multimedia" (in russian) . ... Automatic building texture completion . Publication Type . Conference Paper . Year of Publication . ... Conference Name . ... Publication Language . ... http://graphics.cs.msu.ru/en/publications/text/gc2006kv.pdf . ...

Еще в разделе: (Показать все результаты (>434) - graphics.cs.msu.ru/ )

• Automatic building texture completion | Лаборатория компьютерной графики и
• Selected completed projects | Graphics and Media Lab
• Fast automatic single-view 3-d reconstruction of urban scenes | Graphics and

Электронная библиотека Попечительского совета . ... Smullyan R.M. - Recursion Theory for Metamathematics . ... Название: Recursion Theory for Metamathematics . Автор: Smullyan R.M. Аннотация: . ... The book deals mainly with those aspects of recursion theory that have applications to the metamathematics of incompleteness, undecidability, and related topics. ... Bar symmetric recursion theorem 116 . ... Электронная библиотека попечительского совета мехмата МГУ , 2004-2016 . ...

Еще в разделе: (Показать все результаты (>112708) - lib.mexmat.ru/ )

• Krattenthaler C., Srinavasa Rao K. - Automatic generation of hypergeometric
• Flajolet P., Gourdon X., Panario D. - The complete analysis of a polynomial
• Wegstein J. (ed.) - Algorithm 165. Complete elliptic integral :: Электронная

TowerEiffel . TowerEiffel is a commercial-quality implementation of Eiffel from Tower Technology Corporation. TowerEiffel is a complete software development environment including standard software development tools as well as extensive libraries for Client/Server development, database, distributed processing and general programming. ... High Performance Eiffel 3 Compiler . ... Multi-language Source Level Debugger . ... None . ... User Comments: . ... SAL Home | ... Languages Compilers . ...

Еще в разделе: (Показать все результаты (>3032) - www.sai.msu.su/ )

• SAL- Programming - Tools & Utilities - GRASP
• SAL- Computer Graphics, Images Signals - Image Viewers, Conversions
• SAL- Numerical Analysis - Discrete Methods Related Tools

... Automatic generation of profiling libraries . Up: The MPE library of useful extensions Next: Tools for Profiling Library Management Previous: Accessing the profiling libraries . For each of these libraries, the process of building the library was very similar. ... do something for profiling library retcode = PMPI_Xxx( . ... It is thus easy to generate profiling libraries. See the README file in mpich/profiling/wrappergen or Appendix Automatic generation of profiling libraries . ...

Еще в разделе: (Показать все результаты (>673) - www.parallel.ru/ )

• Automatic Report Generation | PARALLEL.RU - Информационно-аналитический центр
• Clarification of MPI_FINALIZE | PARALLEL.RU - Информационно-аналитический центр
• Writing wrapper definitions | PARALLEL.RU - Информационно-аналитический центр

... Length = 194692 Score = 28.2 bits (14), Expect = 1.0 Identities = 14/14 (100%) Strand = Plus / Plus Query: 14 gggattcgaacccc 27 || ... Sbjct: 157615 cccttagcaggggcgcctcttcagcc 157640 Score = 26.3 bits (13), Expect = 4.1 Identities = 13/13 (100%) Strand = Plus / Plus Query: 14 gggattcgaaccc 26 || Sbjct: 158927 gggattcgaaccc 158939 Score = 26.3 bits (13), Expect = 4.1 Identities = 13/13 (100%) Strand = Plus / Plus Query: 14 gggattcgaaccc 26 || ...

Еще в разделе: (Показать все результаты (>4002) - kodomo.cmm.msu.ru/ )

• http://kodomo.cmm.msu.ru/~vanilin/3_1/tRNA_blastn.txt
• http://kodomo.cmm.msu.ru/~ivyura/Term3/files/blastn_ss_res.txt
• http://kodomo.cmm.msu.ru/~phoenix/term3/resultblastn2.txt

A problem, that can arise when moving from Fortran 77 to Fortran 90, is dependent on a usual deviation from the standard, and has to do especially with user programs. ... With many Fortran 77 implementations we wrote PROGRAM TEST REAL X WRITE(*,10) 10 FORMAT('Give X = ',$) READ(*,*) X WRITE(*,*) X END In Fortran 90 we use "non-advancing I/O" instead. ... In some old Fortran dialects the statement TYPE was used to write on a typewriter terminal and PRINT was used to write on the line printer. ...

Еще в разделе: (Показать все результаты (>15608) - crydee.sai.msu.ru/ )

• Recursion

... TWiki ? TWikiSiteTools . ... In particular, TWiki provides two highly configurable, automated site monitoring tools, WebNotify , to email alerts when topics are edited, and WebStats , to generate detailed activity reports. ... The script sends an automated email to subscribed users if topics were changed in a web within last interval. ... You can use the topic in the Main web as a template. ... Note: Please contribute updates to this topic on TWiki.org at TWiki:TWiki.TWikiSiteTools . ...

Еще в разделе: (Показать все результаты (>38635) - dualopt1.cmm.msu.ru/ )

• %TOPICTITLE% ( vs. 1) - TWiki
• TWikiUIViewDotPm - TWiki - TWiki
• %TOPICTITLE% (2 vs. 3) - TWiki

-2015 Gentoo Foundation # Distributed under the terms of the GNU General Public License v2 # $Id$ EAPI=5 inherit bash-completion-r1 git -2 elisp-common DESCRIPTION= Stores, retrieves, generates, and synchronizes passwords securely using gpg, pwgen, and git HOMEPAGE= http://www.passwordstore.org/ EGIT_REPO_URI= http:// git .zx2c4.com/password-store SLOT= 0 LICENSE= GPL-2 KEYWORDS= IUSE= + ...

Еще в разделе: (Показать все результаты (>19457) - mirror.msu.net/ )

• http://mirror.msu.net/pub/gentoo-portage/app-admin/pass/pass-1.6.5.ebuild
• http://mirror.msu.net/pub/rfc-editor/rfc-ed-all/pdfrfc/rfc131.txt.pdf
• http://mirror.msu.net/pub/rfc-editor/rfc-ed-all/rfc131.txt

... MG1655, complete genome. (927 letters) Database: pm 204 sequences; 2,269,587 total letters Searching..................................................done Score E Sequences producing significant alignments: (bits) Value AE006203 Pasteurella multocida subsp. multocida str. Pm70 sectio.. ... 28 6.5 AE006163 Pasteurella multocida subsp. multocida str. ... Length = 10697 Score = 30.2 bits (15), Expect = 1.6 Identities = 15/15 (100%) Strand = Plus / Plus Query: 193 cgcatgattctgctt 207 || ...

Еще в разделе: (Показать все результаты (>18691) - kodomo.fbb.msu.ru/ )

• http://kodomo.fbb.msu.ru/~element/Term3/pm.txt
• http://kodomo.fbb.msu.ru/~element/Term3/search_3T.txt
• allpy: 1e5116ce9d75 .hgignore

... According to Formal-Logical Approach to Organic Reactions, the systematical search for new, unprecedented types of chemical interconversions needs the complete sets of symbolic, reaction, structural, and skeletal equations to be generated. ... The basic ideas of the effective generating algorithms, some results of the corresponding analytical enumeration techniques, and several new reaction types found by computer programs, are also discussed. ...

Еще в разделе: (Показать все результаты (>565) - chem.msu.ru/ )

• Similarity and difference of exciplexes with complete and partial electron
• The ARGENT Program System: A Second-Generation Tool Aimed at Systematic Search

This module is contained in the mod_dir.c file, and is compiled in by default. It provides for "trailing slash" redirects and serving directory index files. ... A file written by the user, typically called index.html . The DirectoryIndex directive sets the name of this file. This is controlled by mod_dir . ... Example: DirectoryIndex index.html then a request for http://myserver/docs/ would return http://myserver/docs/index.html if it exists, or would list the directory if it did not. ...

Еще в разделе: (Показать все результаты (>731) - rtm-cs.sinp.msu.ru/ )

• Qt Toolkit - QNPStream Class
• Qt Toolkit - QIconSet Class
• Apache modules

This module provides for "trailing slash" redirects and serving directory index files. ... A file written by the user, typically called index.html . ... A "trailing slash" redirect is issued when the server receives a request for a URL http://servername/foo/dirname where dirname is a directory. ... Module: mod_dir . ... Example: DirectoryIndex index.html then a request for http://myserver/docs/ would return http://myserver/docs/index.html if it exists, or would list the directory if it did not. ...

Еще в разделе: (Показать все результаты (>72) - neptun.sai.msu.ru/ )

• Apache modules

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>18) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/megablast.out

i 1 Summar y of 3 P3 "Simulations and Computations in Theoretical Physics and Phenomenology": -- Automated Calculation and Simulation Systems -- Thorsten Ohl и -- Universitat Wurzburg -- и ohl@physik.uni-wuerzburg.de ACAT 2002, Moscow State University, June 28, 2002 Th. ... Status and Trends at ACAT 2002 . ... Ohl Automatic Calculation Systems ACAT 2002 Mission Fully automated calculation and simulation systems in par ticle physics aim to produce model parameters process e. g. cuts L m, g, . ...

Еще в разделе: (Показать все результаты (>64) - acat02.sinp.msu.ru/ )

• http://acat02.sinp.msu.ru/presentations/huhlaev/Metamake.doc

Filename completion is only available if the the environment variables EDITOR and/or VISUAL are set to either emacs , gmacs or vi . For example: EDITOR=emacs . ... To complete a file or directory name with emacs or gmacs set press the ESC key twice. ls -l on<ESC><ESC> line_help . If the filename is not completed enter more characters until the filename can be uniquely identified. ... To complete a file or directory name with vi set press the \ (backward slash) key. ls -l on\ line_help . ...

Еще в разделе: (Показать все результаты (>105) - comet.sai.msu.ru/ )

• Filename completion
• Filename completion with the C shell
• Filename completion with the Bourne Again SHell

Below is a list of all of the modules that come as part of the Apache distribution. ... mod_setenvif Apache 1.3 and up . Set environment variables based on client information . mod_unique_id Apache 1.3 and up . ... Determining document types using file extensions . ... mod_rewrite Apache 1.2 and up . ... User authentication using text files . ... User authentication using DBM files . ... User authentication using Berkeley DB files . mod_auth_anon Apache 1.1 and up . ...

Еще в разделе: (Показать все результаты (>377) - oit.cmc.msu.ru/ )

• readline_completion_function
• PHP's Automatic Build System
• Parser behavior

О лаборатории . ... Лаборатория теоретической биофизики . ... OPLS-AA topology generation is a very complex task because of huge amount of the atomtypes described this force field. ... We use OPLS-AA with some includings; ?includings? are overlays on the standart GROMACS forcefield files. ... All-atom automatic OPLS-AA topology generator . ... comcon1 in All-atom automatic OPLS-AA topology? . ... OPLS-AA? in All-atom automatic OPLS-AA topology? ... 2011 ERG Research Group . ...

Еще в разделе: (Показать все результаты (>57) - erg.biophys.msu.ru/ )

• Nanotubes generating script for PyMol ERG Research Group: Лаборатория
• Peter Mamonov ERG Research Group: Лаборатория теоретической биофизики
• Reaction-diffusion systems in 2D space with python ERG Research Group:

... Кафедра общей экологии Биологического факультета МГУ им. М.В. Ломоносова и . ... Экологический Форум - Фундаментальная Экология : Предложения и замечания по сайту . Тема: Generate More Sales By Using These SEO Ti . ... It really is more efficient than the usual link exchange, and both sites receive new content. ... Переход на форум -- Выберите форум -- О сайте "Фундаментальная экология" - Предложения и замечания по сайту Научные семинары - Научные семинары . ...

Еще в разделе: (Показать все результаты (>3667) - www.sevin.ru/ )

• Экологический Форум - Фундаментальная Экология: that will generate a peril on
• Экологический Форум - Фундаментальная Экология: Generate More Sales With One Of
• Экологический Форум - Фундаментальная Экология: i just completed a whole

... Next message: [Comphep-common] width and branching ratios in batch mode . ... Dear Pawel! ... On Wed, 5 Nov 2003, Pawel Zych wrote: > hi, > I've got a question concering generation of events in comphep. I've already got a file 'events_N' and the next step is according > to manual > http://theory.sinp.msu.ru/comphep_html/tutorial/node44.html > execution of $COMPHEP/genEvents, but it is nowhere. > can you help me? > > cheers, pawel > -- Dr. Alexander Kryukov Inst. of Nuclear Physics, Moscow Univ, | ...

Еще в разделе: (Показать все результаты (>1243) - theory.sinp.msu.ru/ )

• The LanHEP Handbook
• [Comphep-common] Events to produce of LHAEF format
• Main facilities

... A Complete Solar Cycle from SOHO . ... Credit Copyright: SOHO - EIT Consortium , ESA , NASA Explanation: Every eleven years, our Sun goes through a solar cycle. ... A solar cycle is caused by the changing magnetic field of the Sun, and varies from solar maximum , when sunspot , coronal mass ejection , and flare phenomena are most frequent, to solar minimum, when such activity is relatively infrequent. ... Publications with words: solar cycle - solar maximum - SOHO . ... A Solar Prominence from SOHO ...

Еще в разделе: (Показать все результаты (>8934) - www.astronet.ru/ )

• A Complete Aurora
• Астронет > A Complete Aurora
• Астронет > A Complete Solar Cycle from SOHO