... Length = 194692 Score = 28.2 bits (14), Expect = 1.0 Identities = 14/14 (100%) Strand = Plus / Plus Query: 14 gggattcgaacccc 27 || ... Sbjct: 157615 cccttagcaggggcgcctcttcagcc 157640 Score = 26.3 bits (13), Expect = 4.1 Identities = 13/13 (100%) Strand = Plus / Plus Query: 14 gggattcgaaccc 26 || Sbjct: 158927 gggattcgaaccc 158939 Score = 26.3 bits (13), Expect = 4.1 Identities = 13/13 (100%) Strand = Plus / Plus Query: 14 gggattcgaaccc 26 || ...

Еще в разделе: (Показать все результаты (>2413) - kodomo.cmm.msu.ru/ )

• http://kodomo.cmm.msu.ru/~vanilin/3_1/tRNA_blastn.txt
• http://kodomo.cmm.msu.ru/~mmetelev/Term3/bln.txt
• http://kodomo.cmm.msu.ru/~contradiction/term3/bln_y.txt

... Online Services | ... Construct your query and output by sequental openings of needed fields. One output field must be selected (not be blank) at least. ... Query parameters: . Select for output . ... Energy (keV) . ... Y D H M S MS US NS PS FS AS EV KEV MEV or Stable . ... Energy of the ?-ray (keV) . ... Energy parameters of nucleus (B , Alpha energy, N, P separation energy) . ... Neutron separation energy (keV) . Proton separation energy (keV) . ... Excited energy(keV) . ...

Еще в разделе: (Показать все результаты (>19) - cdfe.sinp.msu.ru/ )

... Flajolet P., Gourdon X., Panario D. - The complete analysis of a polynomial factorization algorithm over finite fields . ... Название: The complete analysis of a polynomial factorization algorithm over finite fields . Авторы: Flajolet P., Gourdon X., Panario D. Аннотация: . ... An outcome is a complete analysis of the standard polynomial factorization chain that is based on the elimination of repeated factors, distinct degree factorization, and equal degree separation. ...

Еще в разделе: (Показать все результаты (>33081) - lib.mexmat.ru/ )

• Deal R. - The Complete Cisco VPN Configuration Guide :: Электронная библиотека
• Salomon D., Bryant D. - Data Compression: The Complete Reference :: Электронная
• Binstock C., Peterson D., Smith M. - The XML Schema Complete Reference ::

... MG1655, complete genome. (927 letters) Database: pm 204 sequences; 2,269,587 total letters Searching..................................................done Score E Sequences producing significant alignments: (bits) Value AE006203 Pasteurella multocida subsp. multocida str. Pm70 sectio.. ... 28 6.5 AE006163 Pasteurella multocida subsp. multocida str. ... Length = 10697 Score = 30.2 bits (15), Expect = 1.6 Identities = 15/15 (100%) Strand = Plus / Plus Query: 193 cgcatgattctgctt 207 || ...

Еще в разделе: (Показать все результаты (>6293) - kodomo.fbb.msu.ru/ )

• http://kodomo.fbb.msu.ru/~element/Term3/pm.txt
• http://kodomo.fbb.msu.ru/~element/Term3/search_3T.txt
• http://kodomo.fbb.msu.ru/~podkovkina/v.txt

... About lab . ... Selected publications . ... Projects . ... Medical image analysis . ... Selected completed projects . Text recognition . Geometric image parsing . Multiple object detection . ... Old projects . ... Online Journal "Computer graphics and multimedia" (in russian) . ... Text detection and recognition in natural images . ... 1) Automatic detection and understanding the text in natural images, such as photographs of city outdoors or building indoors, is a challenging problem. ...

Еще в разделе: (Показать все результаты (>277) - graphics.cs.msu.ru/ )

• Graphics and Media Lab | CMC department, Lomonosov Moscow State University
• Grants and contracts | Graphics and Media Lab

... The command to be executed can be given to pppd with the connect command line option. pppd will redirect the command's standard input and output to the serial line. ... Basically, a chat script consists of an alternating sequence of strings that we expect to receive from the remote system, and the answers we are to send. ... This is a typical excerpt from a chat script; ogin: b1ff ssword: s3kr3t This tells chat to wait for the remote system to send the login prompt, and return the login name b1ff. ...

Еще в разделе: (Показать все результаты (>377) - itpm.msu.su/ )

• Getting smail Up and Running
• The Login Chat

. [ Войти ] . Главная -> Фильмы -> Tales of the Unexpected . Пользователи . Демо . Деньги . Фильмы . Форум . Tales of the Unexpected . Великобритания 1979 . отметить . Сериал . Ужасы . Триллер .

Еще в разделе: (Показать все результаты (>413) - kinfo.ru/ )

• An Unexpected Love - Фильмы - Kinfo.ru
• The Unexpected Pest - Фильмы - Kinfo.ru
• The Unexpected Mrs. Pollifax - Фильмы - Kinfo.ru

Brain Research Group >> Research >> Change-point analysis ... << previous next >> . ... Unless in many other approaches to the analysis of different signal coupling, the information entering the analysis of synchronization in our approach is explicitly represented in the form of elementary, instantaneous events (the change-points). ... Hence the use of correlation/coherency estimates in parallel with change-point analysis seems to be quite rational. ...

Еще в разделе: (Показать все результаты (>71) - brain.bio.msu.ru/ )

• Change-point synchronization between signals or signal components
• Nonparametric approaches to the description of EEG piecewise stationary
• Analysis of change-point synchronization in multi-channel EEG

... FIELD | ... java.lang.Object common.Task . ... public class Task . ... private java.lang.String . ... private boolean . ... private java.util.Vector . ... static int . ... private UserInfo . userInfo . ... void . ... Method Detail public void setUserInfo ( UserInfo userInfo) . ... public void setFiles (java.util.Vector in, java.util.Vector inout, java.util.Vector out) . public void setHost (java.lang.String host, java.lang.String prog, java.lang.String cgibin, java.lang.String cgibinLocal) . ...

Еще в разделе: (Показать все результаты (>181) - angel.cs.msu.su/ )

... NonmonotoneNature of Erythrosytes Sedimentation in Whole Blood as Revealed by Video Recording with High Space-Time Resolution . Abstract (Non-linear dynamic behavior of blood sedimentation has been revealed due to application of the principles of the system of technical vision for the detailed analysis of red blood sedimentation kinetics. ... Several unexpected phenomena in the process of red blood sedimentation have been revealed. ... Moscow University Chemistry Bulletin . 2011, Vol. ...

Еще в разделе: (Показать все результаты (>1621) - chem.msu.ru/ )

• Similarity and difference of exciplexes with complete and partial electron
• Moscow University Chemistry Bulletin Vol. 53, No. 6, P. 413 (2012)
• Moscow University Chemistry Bulletin Vol. 49, No. 5, P. 306 (2008)

... B Design and developmentof a new vacuum chamber for the tests of Q-factors in suspension's modes . ... E New SQL free principle of coordinate monitoring of the test mass . F Appendix I . ... The achieved p new resolution 2 10;11cm= Hz was su cient to record Brownian vibration with relative accuracy better than 10% (see details in Appendix I). ... See details in Appendix IV) E. New SQL free principle of coordinate monitoring of the test mass The new concept of quantum measurement | ...

Еще в разделе: (Показать все результаты (>96) - hbar.phys.msu.ru/ )

. This page uses frames, but your browser doesn't support them.

Еще в разделе: (Показать все результаты (>71) - chaos.phys.msu.ru/ )

... Laboratory of Mathematical Methods of Image Processing . ... Image analysis . ... Ringing effect . ... It can be efficiently used as a post-processing method for global image deblurring methods . ... Development of edge width estimation algorithm is important for image enhancement and image quality analysis methods. ... Ringing effect so known as Gibbs phenomenon in mathematical methods of image processing is the annoying effect in images and video appeared as rippling artifact near sharp edges. ...

Еще в разделе: (Показать все результаты (>295) - imaging.cmc.msu.ru/ )

• Computer Tomography image filtering | Laboratory of Mathematical Methods of

Analysis of the ANTARES data for SN neutrino detection V. Kulikovskiy (MSU / INFN Genova) Hit counts in the detector. The number of hits ( hit counts ) in a time slice (104.8 ms) is used (this information is stored in each run) Mean number of hit counts in one PMT is ~5500 (corresponds to ~55 kHz) Expected number of hits from SN in 100ms is 11.6 ( 550 0) Bioluminescence bursts should be excluded Bioluminescence cut We have collected distributions of hit counts for each ...

Еще в разделе: (Показать все результаты (>22) - antares.sinp.msu.ru/ )

• http://antares.sinp.msu.ru/docs/Gracheva_Bamberg_22.09.11.pdf

Proceedings of Turbulent Shear Flows XI , 1997. NASA Technical Paper # 3555 , 1997. Proceedings of European Turbulence Conference VI , 1996. ESPRI Research Report # 104, 117-143 (1996) . ... Proceedings of Turbulent Shear Flows X , 1995. ASME Paper 95-GT-437 , 1995. ... Invited AIAA Paper 94-2281 presented at the 1994 AIAA Fluid Dynamics Conference, Colorado Springs, CO. AIAA Paper 94-2323, presented at the 1994 AIAA Fluid Dynamics Conference, Colorado Springs, CO. ...

Еще в разделе: (Показать все результаты (>2833) - crydee.sai.msu.ru/ )

• Unsteady boundary layer transition
• Historical Notes

... Two-dimension linear regression model. ... The econometric modeling of time series . ... The course aims to provide students with basic models and methods of econometric modeling of financial time series. ... The course considers in detail the major methods of econometric modeling of time series, in particular modeling by stochastic processes, modeling of stationary and non-stationary time series, the spectrum analysis of time series. ... The problem of tax optimization under a given state budget. ...

Еще в разделе: (Показать все результаты (>18) - io.cmc.msu.ru/ )

... Determine type of branching, explain 3. Determine architectural model (use key from Halle et al. ... Determine phyllotaxis type and formula of spiral phyllotaxis (if applicable), explain 5. Write detailed description of leaf of each plant species (see plan below). ... Plan of leaf description: 1. General characters (leaf as a whole): (a) symmetry (symmetrical / asymmetrical); (b) stipules (present / absent, deciduous / not); (c) base (sheath / no, ligule /no, auricles /no) 2. ...

Еще в разделе: (Показать все результаты (>207) - herba.msu.ru/ )

• Fucus vesiculosus: detailed view
• Ascophyllum nodosum: detailed view
• Enteromorpha intestinalis: detailed view

Выберите категорию обращения: Общие вопросы Отчеты Рейтинги Диссертационные советы Конкурсы Ввод данных Структура организаций Пользователи Проблемы с регистрацией\входом в систему . ... Войти в систему . ... Другие названия журнала: Kybernetik@ . Издательство: Akademie Ved Ceske Republiky . ... в журнале Kybernetika , издательство Akademie Ved Ceske Republiky (Czech Republic) , том 24, ? ...

Еще в разделе: (Показать все результаты (>2641) - istina.msu.ru/ )

• SPE Drilling and Completion - журнал | ИСТИНА - Интеллектуальная Система
• VASIN V.A. - сотрудник | ИСТИНА - Интеллектуальная Система Тематического
• Voloshin Yan Z. - сотрудник | ИСТИНА - Интеллектуальная Система Тематического

... TWiki ? ... Enhancements in TWiki 4.3.0 . ... TWiki 4.3.0 released on 30 Mar 2009 introduces security enhancements, usability enhancements, feature enhancements, and adds extensions to strengthen TWiki as an enterprise collaboration platform. ... Replace question mark links with red-links to point to non-existing topics . ... Search Enhancements . Add footer parameter to Formatted Search . Add number of topics to Formatted Search . ... Search: Add Number of Topics to Formatted Search . ...

Еще в разделе: (Показать все результаты (>36723) - dualopt1.cmm.msu.ru/ )

• %TOPICTITLE% ( vs. 1) - TWiki
• %TOPICTITLE% (12 vs. 13) - TWiki
• %TOPICTITLE% (2 vs. 3) - TWiki

Filename completion is only available if the the environment variables EDITOR and/or VISUAL are set to either emacs , gmacs or vi . For example: EDITOR=emacs . ... To complete a file or directory name with emacs or gmacs set press the ESC key twice. ls -l on<ESC><ESC> line_help . If the filename is not completed enter more characters until the filename can be uniquely identified. ... To complete a file or directory name with vi set press the \ (backward slash) key. ls -l on\ line_help . ...

Еще в разделе: (Показать все результаты (>133) - comet.sai.msu.ru/ )

• Filename completion
• Filename completion with the C shell
• Filename completion with the Bourne Again SHell