... Length = 194692 Score = 28.2 bits (14), Expect = 1.0 Identities = 14/14 (100%) Strand = Plus / Plus Query: 14 gggattcgaacccc 27 || ... Sbjct: 157615 cccttagcaggggcgcctcttcagcc 157640 Score = 26.3 bits (13), Expect = 4.1 Identities = 13/13 (100%) Strand = Plus / Plus Query: 14 gggattcgaaccc 26 || Sbjct: 158927 gggattcgaaccc 158939 Score = 26.3 bits (13), Expect = 4.1 Identities = 13/13 (100%) Strand = Plus / Plus Query: 14 gggattcgaaccc 26 || ...

Еще в разделе: (Показать все результаты (>4633) - kodomo.cmm.msu.ru/ )

• http://kodomo.cmm.msu.ru/~vanilin/3_1/tRNA_blastn.txt
• http://kodomo.cmm.msu.ru/~phoenix/term3/resultblastn2.txt
• http://kodomo.cmm.msu.ru/~dragon98/term3/files/blasn.out

... Query = PYRB_ECOLI P0A786 Aspartate carbamoyltransferase catalytic chain (EC 2.1.3.2) (Aspartate transcarbamylase) (ATCase). (311 letters) Database: pm 204 sequences; 2,269,587 total letters Searching..................................................done Score E Sequences producing significant alignments: ( bits ) Value embl |AE006119|AE006119 Pasteurella multocida subsp . multocida st... 77 9e-16 embl |AE006208|AE006208 Pasteurella Pm70 section 86 of 204 of the complete genome. ...

Еще в разделе: (Показать все результаты (>31336) - kodomo.fbb.msu.ru/ )

• http://kodomo.fbb.msu.ru/~element/Term3/search_3T.txt
• http://kodomo.fbb.msu.ru/~element/Term3/blast_3.txt
• http://kodomo.fbb.msu.ru/~ogion/projects/Evolution_of_sequences/hemn_yp.blast

... Online Services | ... Construct your query and output by sequental openings of needed fields. One output field must be selected (not be blank) at least. ... Query parameters: . Select for output . ... Energy (keV) . ... Y D H M S MS US NS PS FS AS EV KEV MEV or Stable . ... Energy of the ?-ray (keV) . ... Energy parameters of nucleus (B , Alpha energy, N, P separation energy) . ... Neutron separation energy (keV) . Proton separation energy (keV) . ... Excited energy(keV) . ...

Еще в разделе: (Показать все результаты (>4916) - cdfe.sinp.msu.ru/ )

• CDFE - Centre for Photonuclear Experiments Data - Home page

Home . ... Activities . ... Laboratory of Mathematical Methods of Image Processing . Chair of Mathematical Physics . ... Image enhancement . ... Rank image filtering . Image analysis . ... Ringing effect . ... Database . ... Medical imaging . ... Multiresolution analysis and processing . ... The final version of the developed ringing database is available here: . ... The ringing extension of TID 2013 database: . ...

Еще в разделе: (Показать все результаты (>178) - imaging.cmc.msu.ru/ )

• Ringing effect modeling | Laboratory of Mathematical Methods of Image...
• Research | Laboratory of Mathematical Methods of Image Processing
• Ringing analysis | Laboratory of Mathematical Methods of Image Processing

... About lab . ... Multiple object detection . ... Online Journal "Computer graphics and multimedia" (in russian) . ... To detect multiple objects of interest, the methods based on Hough transform use non-maxima supression or mode seeking in order to locate and to distinguish peaks in Hough images. ... Iterations of the Hough-like algorithm for multiple object instances detection: . ... Barinova O, Lempitsky V, Kohli P. On detection of multiple object instances using Hough transform . ...

Еще в разделе: (Показать все результаты (>222) - graphics.cs.msu.ru/ )

• Video processing | Graphics and Media Lab
• Selected completed projects | Graphics and Media Lab
• Automatic building texture completion | Graphics and Media Lab

. ЭКОЛОГИЧЕСКАЯ ИНФОРМАЦИЯ . WEB- ориентированная библиографическая база данных .

Еще в разделе: (Показать все результаты (>22) - ecoinformatica.srcc.msu.ru/ )

... Alexey D. Neverov . ... Department of Bioengineering and Bioinformatics, Moscow State University. State Scientific Center GosNIIGenetika. ... EDAS human . EDAS mouse . EDAS dog (not availible now) . EDAS rat (not availible now) . To navigate this site please install the latest version of Macromedia Flash Player for Windows or for Linux . If you do not wish to install Flash you could use text pages with less functionality. ...

Еще в разделе: (Показать все результаты (>7) - edas2.bioinf.fbb.msu.ru/ )

• Alternative Splicing DataBase.
• EDAS (human) - Alternative Splicing DataBase.
• EDAS (mouse) - Alternative Splicing DataBase.

About BAFIZ . ... BAFIZ is a program devoted to the development of a distributed network of the knowledge and data bases for research of fundamental properties of the matter and applied nuclear physics. The project sponsored by Russian Foundation of Basic Research , RFBR reference number is 95-07-19502. ... This Page is developed at Laboratory of Computational Mathematics, . ... Last updated on 2 September 1999 . Copyright 1999 Laboratory of Computational Mathematics (DRCM) ...

Еще в разделе: (Показать все результаты (>25) - dbserv.sinp.msu.ru/ )

... Exciplexes with medium extent of electron transfer formed at the interaction of excited molecules with weak donors and acceptors (DGet> -0.2 eV) can be observed even in polar solvents contrary to the well investigated exciplexes with complete extent of electron transfer. ... hDn = H12/(1/ c12 - 1)1/2 - c14 (m02/a3) f(n2) . ... Parameters (H220-H110), H12, and (m02/a3) for each exciplex can be found by the fitting of the experimental dependence of hDn on f(e). ...

Еще в разделе: (Показать все результаты (>626) - chem.msu.ru/ )

• Similarity and difference of exciplexes with complete and partial electron
• Ivan Sorokin
• Effective Syntheses of Group 4 Substituted Niobocenes

Filename completion is only available if the the environment variables EDITOR and/or VISUAL are set to either emacs , gmacs or vi . For example: EDITOR=emacs . ... To complete a file or directory name with emacs or gmacs set press the ESC key twice. ls -l on<ESC><ESC> line_help . If the filename is not completed enter more characters until the filename can be uniquely identified. ... To complete a file or directory name with vi set press the \ (backward slash) key. ls -l on\ line_help . ...

Еще в разделе: (Показать все результаты (>159) - comet.sai.msu.ru/ )

• Filename completion
• Filename completion with the C shell
• Filename completion with the TC shell

In our model for RNA secondary structure formation we assume that each of the candidate helices (see definition in the main text) may exist in two states. A helix can be completely zipped, or it can be completely decayed. ... The following schema is used to estimate the effective transition constants between zipped and decayed states: . ... To determine the kinetic constants, we use the transition state theory, which is often used in chemical kinetics (Figure 2). ... Transition . ...

Еще в разделе: (Показать все результаты (>143) - bioinf.fbb.msu.ru/ )

• SDPsite - Gallery of examples

Data are provided with the intent that they are readily available for personal and public non-commercial use and may be reproduced, in part or in whole and by any means, without charge or further permission from IWSG. However, proper reference to contributors of original data to the database must be provided in all cases, and due diligence should be exercised in ensuring the accuracy of the materials reproduced . ... Bird species report. In : ARCTIC BIRDS breeding conditions survey . ...

Еще в разделе: (Показать все результаты (>3) - arctic.ss.msu.ru/ )

• BIRDS SPECIES DATABASE of the Arctic Birds Breeding Conditions Survey

Welcome to TWiki.. Users , Groups . ... Main ? ... ElenaZavyalova . ... TWikiUsersGuide - complete TWiki documentation, Quick Start to Reference . ... ChangePassword for changing your password . ChangeEmailAddress for changing your email address . TWikiUsers has a list of other TWiki users . UserDocumentationCategory is a list of TWiki user documentation . UserToolsCategory lists all TWiki user tools . ... Address: . ... Users . ... Copyright &© by the contributing authors. ...

Еще в разделе: (Показать все результаты (>35242) - dualopt1.cmm.msu.ru/ )

• AlexKopylov - Main - TWiki
• AndreyGolovin - Main - TWiki
• AndreyGolovin - Main - TWiki - (printable)

The Database of Close Binary Systems . ... Team . ... This web-based interactive database is being developed and maintained by a team at the Sternberg Astronomical Institute of the Moscow State University . The project is an on-line extension of our catalogue on "Highly Evolved Close Binary Stars" (volumes I, II) published by Gordon and Breach in 1996. As of September 2009, the database (both the software and the content) is in its development/testing phase. ...

Еще в разделе: (Показать все результаты (>3) - dionis.sai.msu.ru/ )

PLTT DISCLAIMER: The PLTT makes no claims of ownership on the copyrighted works of O(+>, the artist formerly known as Prince, aka Prince Rogers Nelson. ... The PLTT, completely through voluntary work, hopes to provide the most comprehensive database of lyrics for the known works of this artist. ... We hope you enjoy our efforts, and contribute by making errors and opinions known to the PLTT by sending mail to pltt@umich.edu. (c) Copyright 1999 Prince Lyric Transcription Team ...

Еще в разделе: (Показать все результаты (>2468) - crydee.sai.msu.ru/ )

• Work notes
• Index of /ftproot/pub/comp/os/os2/leo/database

MCQDPT vs. XMCQDPT: low-lying excited states of O3 molecule Ilya G. Ryabinkin1 , Laboratory of Quantum Mechanics and Molecular Structure, Chemistry Department of Moscow State University, 119991, Leninskie Gory 1-3, Moscow, Russia. ... XMCQDPT: low-lying excited states of O3 Introduction: A brief overview of MCQDPT theory Reliable, cost-effective alternative to other multi-reference (MR) approaches, such as MR-CI(+Q), ic -MRCI, MR-AQCC and MR-ACPF. ... XMCQDPT: low-lying excited states of O3 ...

Еще в разделе: (Показать все результаты (>65) - classic.chem.msu.su/ )

• Firefly DOCUMENTATION - command line arguments

. [ Войти ] . Главная -> Фильмы -> Lego Star Wars: The Complete.. Пользователи . Демо . Деньги . Фильмы . Форум . Lego Star Wars: The Complete Saga . Великобритания 2007 . отметить . Комедия . Фантастика . Игра . Фэнтэзи . Боевик .

Еще в разделе: (Показать все результаты (>494) - kinfo.ru/ )

• Complete Savages - Фильмы - Kinfo.ru
• The Completely Mental Misadv.. - Фильмы - Kinfo.ru
• A Complete History of My Sex.. - Фильмы - Kinfo.ru

. Please use the reference to MASTER DataBase as Lipunov et al., 2010, MASTER Robotic Net, Advances in Astronomy, vol. 2010, pp. 1-7 . - days . MASTER , 2002-2016

Еще в разделе: (Показать все результаты (>3) - apollo.sai.msu.ru/ )

• Dome Kislovodsk Database ::
• Astelco Kislovodsk Database ::

Brain Research Group >> Research >> Change-point analysis ... << previous next >> . ... It is necessary to note that a change-point detection method which we applied to a real EEG signal was developed on the basis of the piecewise stationarity model of the signal. ... The data presented in this Chapter demonstrate that the effective detection of the change-points opens the way for a number of new methods of the analysis of complex signals such as the EEG. ...

Еще в разделе: (Показать все результаты (>55) - brain.bio.msu.ru/ )

• EEG Databases Links
• EEG Database - Schizophrenia
• Other prospects of the change-point based analysis

... The RADEN data bank produced at the Department of Chemistry of Moscow State University is designed as well to accumulate published information on radiative parameters of diatomic molecules, as to analyse it and recommend the more reliable values. ... electronic transition moments D ( R ); . ... dipole moments, . ... FACTUAL RECOMMENDED DATABASE contains now the ab initio and experimental electronic transition moments for more than 250 band systems which belong to more than 100 diatomic molecules. ...

Еще в разделе: (Показать все результаты (>79) - electr003.chem.msu.ru/ )