... Length = 194692 Score = 28.2 bits (14), Expect = 1.0 Identities = 14/14 (100%) Strand = Plus / Plus Query: 14 gggattcgaacccc 27 || ... Sbjct: 157615 cccttagcaggggcgcctcttcagcc 157640 Score = 26.3 bits (13), Expect = 4.1 Identities = 13/13 (100%) Strand = Plus / Plus Query: 14 gggattcgaaccc 26 || Sbjct: 158927 gggattcgaaccc 158939 Score = 26.3 bits (13), Expect = 4.1 Identities = 13/13 (100%) Strand = Plus / Plus Query: 14 gggattcgaaccc 26 || ...

Еще в разделе: (Показать все результаты (>4398) - kodomo.cmm.msu.ru/ )

• http://kodomo.cmm.msu.ru/~phoenix/term3/resultblastn2.txt
• http://kodomo.cmm.msu.ru/~vanilin/3_1/tRNA_blastn.txt
• http://kodomo.cmm.msu.ru/~dragon98/term3/files/blasn.out

... Online Services | ... Construct your query and output by sequental openings of needed fields. One output field must be selected (not be blank) at least. ... Query parameters: . Select for output . ... Energy (keV) . ... Y D H M S MS US NS PS FS AS EV KEV MEV or Stable . ... Energy of the ?-ray (keV) . ... Energy parameters of nucleus (B , Alpha energy, N, P separation energy) . ... Neutron separation energy (keV) . Proton separation energy (keV) . ... Excited energy(keV) . ...

Еще в разделе: (Показать все результаты (>4918) - cdfe.sinp.msu.ru/ )

• CDFE - Centre for Photonuclear Experiments Data - Home page

Next: Delivering Messages to Local Up: Routing Messages Previous: Routing Messages . smail expects to find the pathalias database in the paths file below /usr/lib/smail. This file is optional, so if you don't want to perform any pathalias routing at all, simply remove any existing paths file. paths must be a sorted ASCII file that contains entries which map destination site names to UUCP bang paths. The file has to be sorted because smail uses a binary search for looking up a site. ...

Еще в разделе: (Показать все результаты (>446) - itpm.msu.su/ )

• MySQL Reference Manual for version 3.23.10-alpha. - A Some MySQL users
• mod_auth_dbm - Apache HTTP Server
• MySQL Reference Manual for version 3.23.10-alpha. - Concept Index

Home . ... Activities . ... Laboratory of Mathematical Methods of Image Processing . Chair of Mathematical Physics . ... Image enhancement . ... Rank image filtering . Image analysis . ... Ringing effect . ... Database . ... Medical imaging . ... Multiresolution analysis and processing . ... The final version of the developed ringing database is available here: . ... The ringing extension of TID 2013 database: . ...

Еще в разделе: (Показать все результаты (>192) - imaging.cmc.msu.ru/ )

• Ringing effect modeling | Laboratory of Mathematical Methods of Image...
• Research | Laboratory of Mathematical Methods of Image Processing
• Ringing analysis | Laboratory of Mathematical Methods of Image Processing

. ЭКОЛОГИЧЕСКАЯ ИНФОРМАЦИЯ . WEB- ориентированная библиографическая база данных .

Еще в разделе: (Показать все результаты (>22) - ecoinformatica.srcc.msu.ru/ )

About BAFIZ . ... BAFIZ is a program devoted to the development of a distributed network of the knowledge and data bases for research of fundamental properties of the matter and applied nuclear physics. The project sponsored by Russian Foundation of Basic Research , RFBR reference number is 95-07-19502. ... This Page is developed at Laboratory of Computational Mathematics, . ... Last updated on 2 September 1999 . Copyright 1999 Laboratory of Computational Mathematics (DRCM) ...

Еще в разделе: (Показать все результаты (>26) - dbserv.sinp.msu.ru/ )

... Alexey D. Neverov . ... Department of Bioengineering and Bioinformatics, Moscow State University. State Scientific Center GosNIIGenetika. ... EDAS human . EDAS mouse . EDAS dog (not availible now) . EDAS rat (not availible now) . To navigate this site please install the latest version of Macromedia Flash Player for Windows or for Linux . If you do not wish to install Flash you could use text pages with less functionality. ...

Еще в разделе: (Показать все результаты (>7) - edas2.bioinf.fbb.msu.ru/ )

• Alternative Splicing DataBase.
• EDAS (human) - Alternative Splicing DataBase.
• EDAS (mouse) - Alternative Splicing DataBase.

... Другие названия журнала: Physics Letters, Section B: Nuclear, Elementary Particle and High-Energy Physics , Phys . ... B , Phys.Lett.B , Physics Letters B , Physics Letters B , Physics Letters B - Nuclear Physics and Particle Physics , Physics Letters , Section B: Nuclear , Elementary Particle and High-Energy Physics , Physics Letter B , Physics Letters B , Physics Letters B , Physics Letters B - Nuclear Physics and Particle ...

Еще в разделе: (Показать все результаты (>5698) - istina.msu.ru/ )

• Physics Letters, Section A: General, Atomic and Solid State Physics - журнал |
• Advances in database technology : proceedings. International Conference on
• Troitsky S.V. - сотрудник | ИСТИНА - Интеллектуальная Система Тематического

... Alignment.process (which is a backwards-compatibility alias) -# XXX - Block.from_alignment with None in either of arguments +from allpy import protein, base def test _new_monomers(): Test creation of monomer objects - s = allpy.base.Sequence() + s = base.Sequence() try: m = s.append_monomer(code1 ...

Еще в разделе: (Показать все результаты (>31982) - kodomo.fbb.msu.ru/ )

• allpy: 61b61f911a1a
• allpy: a1307c0bb030 sandbox/ttk.py
• allpy: a1307c0bb030 allpy/fileio.py

PLTT DISCLAIMER: The PLTT makes no claims of ownership on the copyrighted works of O(+>, the artist formerly known as Prince, aka Prince Rogers Nelson. ... The PLTT, completely through voluntary work, hopes to provide the most comprehensive database of lyrics for the known works of this artist. ... We hope you enjoy our efforts, and contribute by making errors and opinions known to the PLTT by sending mail to pltt@umich.edu. (c) Copyright 1999 Prince Lyric Transcription Team ...

Еще в разделе: (Показать все результаты (>2828) - crydee.sai.msu.ru/ )

• Work notes
• Index of /ftproot/pub/comp/os/os2/leo/database
• Fortran 95

. [ Войти ] . Главная -> Фильмы -> Expecting . Пользователи . Демо . Деньги . Фильмы . Форум . Expecting . Канада 2002 . отметить . Комедия . Драма .

Еще в разделе: (Показать все результаты (>308) - kinfo.ru/ )

• Tales of the Unexpected - Фильмы - Kinfo.ru
• Expecting Love - Фильмы - Kinfo.ru
• The Unexpected Pest - Фильмы - Kinfo.ru

... Earth . Earth, and planetary tectonics . ... Earth, tectonic features of . ... Effective elastic thickness of a plate . ... Elastic deformation . Elastic deformation mechanisms . Elastic deformation, definition of . Elastic deformation, experimental fractures and . ... Elasticity . ... Elasticity, elastic behavior . ... En echelon . En echelon fractures . ... Extension . ... Extension fractures, fracture plane for . ... Extension fractures, vs. shear fractures . ... Extensional . ...

Еще в разделе: (Показать все результаты (>483) - geo.web.ru/ )

• COMAGMAT MODEL
• Geochemical Rock Database - Все о Геологии (geo.web.ru)
• Mineralogy Database - Все о Геологии (geo.web.ru)

... E. Huhlaev, Metamake Tools for Personal Project Preparation in Heterogeneous Network Environment (ID=260), Word doc . ... O. Kodolova, Experience with OO Database for CMS Events Distributed Between Two Sites (ID=294), PDF file . ... A. Nikitin, The GA Based Approach to Optimization of Parallel Calculations in Large Physics Problems (ID=220), Word doc . ... J. Seixas, Neural Particle Discrimination for Triggering Interesting Physics Channels Using Calorimetry Data (ID=311), PDF file . ...

Еще в разделе: (Показать все результаты (>48) - acat02.sinp.msu.ru/ )

• http://acat02.sinp.msu.ru/presentations/ivanchenko/iv.pdf
• http://acat02.sinp.msu.ru/presentations/shawhan/shawhan_plenary.pdf

The Database of Close Binary Systems . ... Team . ... This web-based interactive database is being developed and maintained by a team at the Sternberg Astronomical Institute of the Moscow State University . The project is an on-line extension of our catalogue on "Highly Evolved Close Binary Stars" (volumes I, II) published by Gordon and Breach in 1996. As of September 2009, the database (both the software and the content) is in its development/testing phase. ...

Еще в разделе: (Показать все результаты (>3) - dionis.sai.msu.ru/ )

. Please use the reference to MASTER DataBase as Lipunov et al., 2010, MASTER Robotic Net, Advances in Astronomy, vol. 2010, pp. 1-7 . - days . MASTER , 2002-2016

Еще в разделе: (Показать все результаты (>3) - apollo.sai.msu.ru/ )

• Dome Kislovodsk Database ::
• Astelco Kislovodsk Database ::

Bird Species Database (BSD) is being compiled in a framework of the Arctic Birds Breeding Conditions Survey (ABBCS) of the International Wader Study Group (IWSG). BSD aims at providing information on distribution, numbers and breeding status of birds in the Arctic, with the focus on last-breaking and, thus usually unpublished information. The primary source of data is questionnaires filled in by contributors to the ABBCS, while data from literature are being added occasionally. ... breeding . ...

Еще в разделе: (Показать все результаты (>3) - arctic.ss.msu.ru/ )

• BIRDS SPECIES DATABASE of the Arctic Birds Breeding Conditions Survey

... The RADEN data bank produced at the Department of Chemistry of Moscow State University is designed as well to accumulate published information on radiative parameters of diatomic molecules, as to analyse it and recommend the more reliable values. ... electronic transition moments D ( R ); . ... dipole moments, . ... FACTUAL RECOMMENDED DATABASE contains now the ab initio and experimental electronic transition moments for more than 250 band systems which belong to more than 100 diatomic molecules. ...

Еще в разделе: (Показать все результаты (>82) - electr003.chem.msu.ru/ )

Базы данных и таблицы . Проект ?Динамика экономического и социального развития России в XIX ? ... проект поддержан РГНФ, ?10-01-12114в) . Электронный ресурс - база данных 'Социально-экономические и политические факторы стачечного движения в России (1895-1904 гг.) Проект РФФИ ? ... Электронный ресурс - база данных "Агитационные материалы общественных движений, организаций и политических партий на начальном этапе массового рабочего протеста в России (1895-1904 гг.) Проект РГНФ ? ...

Еще в разделе: (Показать все результаты (>148) - hist.msu.ru/ )

... About lab . ... Online Journal "Computer graphics and multimedia" (in russian) . ... Image Database Retrieval by Fast Hermite Projection Method . ... http://graphics.cs.msu.ru/en/publications/text/gc2005kk.pdf . ...

Еще в разделе: (Показать все результаты (>209) - graphics.cs.msu.ru/ )

• Removal of comb effect from video | Лаборатория компьютерной графики и
• Removal of comb effect from video | Graphics and Media Lab
• Removing of blocking effect from video | Graphics and Media Lab

1) Soil Science Faculty, Moscow State University, Moscow 119899, Russia . 2) Faculty of Physics, Moscow State University, Moscow 119899, Russia . ... Long-term response of sandy podzols to acid deposition near the nickel smelter in the Kola Peninsula, north-western Russia, was evaluated with the SMART model. The present acid load does not effect considerably on forest soils in background areas. The dramatic shift in soil chemistry near the smelter is expected within several decades. ...

Еще в разделе: (Показать все результаты (>29) - eco.soil.msu.ru/ )

• Effects of Acid Deposition on Forest Soils in Northernmost Russia: Modelled and