log . ... Tue, 23 Nov 2010 16:55:03 +0300 . boris (netbook) . ... Fri, 19 Nov 2010 11:44:04 +0300 . ... Mon, 22 Nov 2010 14:05:30 +0300 . ... Updated debian package revision number to force installation of updated python-allpy . ... Thu, 18 Nov 2010 23:51:20 +0300 . ... Wed, 17 Nov 2010 21:06:18 +0300 . ... Sun, 14 Nov 2010 21:57:44 +0300 . ... Sun, 31 Oct 2010 18:04:29 +0300 . ... Thu, 28 Oct 2010 20:35:29 +0400 . ... Wed, 27 Oct 2010 08:25:11 +0400 . ... Tue, 26 Oct 2010 22:23:09 +0400 . ...

Еще в разделе: (Показать все результаты (>109046) - kodomo.fbb.msu.ru/ )

... About lab . ... Selected publications . ... Projects . ... Medical image analysis . ... Selected completed projects . Text recognition . Geometric image parsing . Multiple object detection . ... Old projects . ... Online Journal "Computer graphics and multimedia" (in russian) . ... Text detection and recognition in natural images . ... 1) Automatic detection and understanding the text in natural images, such as photographs of city outdoors or building indoors, is a challenging problem. ...

Еще в разделе: (Показать все результаты (>819) - graphics.cs.msu.ru/ )

• Graphics and Media Lab | CMC department, Lomonosov Moscow State University
• Grants and contracts | Graphics and Media Lab
• Automatic building texture completion | Graphics and Media Lab

... Clarification of MPI_FINALIZE . ... Each process must call MPI_FINALIZE before it exits. ... MPI_FINALIZE is collective on MPI_COMM_WORLD. ... Although it is not required that all processes return from MPI_FINALIZE, it is required that at least process 0 in MPI_COMM_WORLD return, so that users can know that the MPI portion of the computation is over. In addition, in a POSIX environment, they may desire to supply an exit code for each process that returns from MPI_FINALIZE. ... Центры . ...

Еще в разделе: (Показать все результаты (>668) - www.parallel.ru/ )

• Independence of Basic Runtime Routines | PARALLEL.RU -
• Clarifications | PARALLEL.RU - Информационно-аналитический центр по
• Communication Completion | PARALLEL.RU - Информационно-аналитический центр по

To turn on filename completion set the shell variable filec by adding the line set filec . to your C shell startup file . To complete a file or directory name press the ESC key. ls -l on<ESC> line_help . If the filename is not completed enter more characters until the filename can be uniquely identified. Directories are shown by the trailing / character. ... cat co<CTRL-D> commands.xdh concepts.xdh conventions/ conver_man/ cat co . ...

Еще в разделе: (Показать все результаты (>241) - comet.sai.msu.ru/ )

• Filename completion with the Korn shell
• Filename completion with the Bourne Again SHell
• Filename completion with the TC shell

Items Added in September & October, 1998: . ... 1998/10/23] . ... Oracle -- powerful database server and applications.[1998/10/23] . ozone -- a multi-user object-oriented database implemented completely in Java.[ ... FC-Plot -- a scientific analysis/visualization tool for Unix/GTK.[ ... eXsas -- extended scientific analysis system for X-ray and XUV data.[ ... Linux Office 99 -- a comprehensive software package of various office applications.[ ... SAL Home | New Items Page | ...

Еще в разделе: (Показать все результаты (>4569) - www.sai.msu.su/ )

• SAL -- Scientific Applications on Linux -- New Items Added in 2000/03 and
• SAL -- Scientific Applications on Linux -- New Items Added in 1997/12
• SAL -- Scientific Applications on Linux -- New Items Added in 1997/07

... Organizing committee . ... Selected papers of MCCMB'13 participants will be published in the Journal of Bioinformatics and Computational Biology . If you plan to submit your paper to the MCCMB issue of JBCB, please send to Prof. M.Gelfand (gelfand 'at' iitp.ru) a short message with a preliminary list of authors and a tentative title of your paper. ... September 30th, 2013 paper submission. ... Select a box stating that the paper goes to the MCCMB issue. ... January 30th, 2014 final decision. ...

Еще в разделе: (Показать все результаты (>235) - mccmb.belozersky.msu.ru/ )

Network Working Group Request for Comments #269 NIC # 7817 Categories: File Transfer Updates: 122, 238, 172 Obsoletes: None H. Brodie UCLA-NMC 6 December 71 Some Experience with File Transfer At UCLA-NMC we have recently completed implementation of a program which utilizes UCSB's storage capability via their Simple Minded File System (See RFC #122 by Jim White for a description of SMFS). ... DF FOO - This deletes the file "FOO" located at UCSB. ... RN FOO BAR - Rename the file "FOO" at UCSB to "BAR". ...

Еще в разделе: (Показать все результаты (>21872) - mirror.msu.net/ )

• http://mirror.msu.net/pub/rfc-editor/rfc-ed-all/rfc269.txt
• http://mirror.msu.net/pub/rfc-editor/rfc-ed-all/rfc131.txt
• http://mirror.msu.net/pub/rfc-editor/rfc-ed-all/pdfrfc/rfc131.txt.pdf

... 2011/12/09 . ... added alignment merging . added parameter corresponding to the width of output alignment . fixed homologue searching for very long query sequences . ... Copyright 2010-2011 Yury Pekov ...

Еще в разделе: (Показать все результаты (>33) - mouse.genebee.msu.ru/ )

• Align tool for DNA-protein complexes

... Length = 194692 Score = 28.2 bits (14), Expect = 1.0 Identities = 14/14 (100%) Strand = Plus / Plus Query: 14 gggattcgaacccc 27 || ... Sbjct: 157615 cccttagcaggggcgcctcttcagcc 157640 Score = 26.3 bits (13), Expect = 4.1 Identities = 13/13 (100%) Strand = Plus / Plus Query: 14 gggattcgaaccc 26 || Sbjct: 158927 gggattcgaaccc 158939 Score = 26.3 bits (13), Expect = 4.1 Identities = 13/13 (100%) Strand = Plus / Plus Query: 14 gggattcgaaccc 26 || ...

Еще в разделе: (Показать все результаты (>7451) - kodomo.cmm.msu.ru/ )

• / (log) тАУ Cyclyc Cell Automata
• GeneBee service result

This example program looks like a complete modern application. ... ApplicationWindow :: ApplicationWindow () : QMainWindow ( 0, example application main window ) { printer = new QPrinter ; printer- setMinMax( 1, 10 ); QPixmap openIcon, saveIcon, printIcon; fileTools = new QToolBar ( this, file operations ); openIcon = QPixmap( fileopen ); QToolButton * fileOpen = new QToolButton ( openIcon, Open File , 0, this, SLOT ( load ()), fileTools, open ...

Еще в разделе: (Показать все результаты (>906) - rtm-cs.sinp.msu.ru/ )

• Submitting Other Snippets

... Bacteria rearranged . ... 2002) . ... Some improvements in Bacteria according Cavalier-Smith (2002b), Woese et al. (2000) and Wolf et al. 2001) . ... Several genera added (Patterson, 1999) . ... Cryothecomonas and Metopion moved (Kuhn et al., ... Major improvements and rearrangements to Protista (Stechmann, Cavalier-Smith, 2002; Cavalier-Smith, 2002; Cavalier-Smith, 2000) . ... Chaetognatha moved to Ecdysozoa, Nematomorpha to Nemathelminthes, Spiralia rearranged (Mallatt, Winchell, 2002) . ...

Еще в разделе: (Показать все результаты (>318) - herba.msu.ru/ )

... The documents on academic background should be translated into Russian and attested by the Russian Embassy in the country where the documents were issued, or by the Embassy of your country in Russia, or by a notary in Russia. Graduation certificate of the Center for International Education at MSU, or Preparatory Course at a state university in Russia, or Certificate of the Russian Language test and tests in Physics and Mathematics, . ... Russian Language Summer Program . ...

Еще в разделе: (Показать все результаты (>28) - foroff.phys.msu.ru/ )

The two main numerical libraries in Fortran 90 are . NAG Numerical Libraries for Fortran 90 Users . IMSL Fortran 90 MP Library Both of these offer both a modified version of the Fortran 77 library, recompiled for Fortran 90, and a completely new library, using all the new facilities of Fortran 90. ... On the Sun using Sun OS 4.2.1 we also got completely wrong results when using library functions in single precision, since the C system on Sun converted all function calls into double precision. ...

Еще в разделе: (Показать все результаты (>4511) - crydee.sai.msu.ru/ )

• Program units
• Adding Variables to CONFIG.SYS
• Keyword arguments and default arguments

... Also during this work Dian drank a lot of tea with sugar, completed his description of urban and rural life (to the tunes of world-known musical "Notre-Dame de Paris"), wrote several poems about his dear friend GVR. ... Besides this project, Sergei A. Spirin with his colleague Andrew V. Alexeevski takes a very great part in different researches. Near their work room on the 3rd floor of the "A" laboratory building, near with the biological one, different colourful posters can be watched. ...

Еще в разделе: (Показать все результаты (>608) - monkey.belozersky.msu.ru/ )

• About this project
• SVETKA, a program for multiple sequence alignments analysus
• SVETKA, a program for multiple sequence alignments analysis

... Кафедра общей экологии Биологического факультета МГУ им. М.В. Ломоносова и . ... Активные темы Список участников Поиск по форуму Помощь . ... Экологический Форум - Фундаментальная Экология : Предложения и замечания по сайту . Тема: i just completed a whole powerpoint prese . ... Переход на форум -- Выберите форум -- О сайте "Фундаментальная экология" - Предложения и замечания по сайту Научные семинары - Научные семинары . Вы не можете публиковать новые темы в этом форуме . ...

Еще в разделе: (Показать все результаты (>3864) - www.sevin.ru/ )

... Online Services | ... Construct your query and output by sequental openings of needed fields. One output field must be selected (not be blank) at least. ... Query parameters: . Select for output . ... Energy (keV) . ... Y D H M S MS US NS PS FS AS EV KEV MEV or Stable . ... Energy of the ?-ray (keV) . ... Energy parameters of nucleus (B , Alpha energy, N, P separation energy) . ... Neutron separation energy (keV) . Proton separation energy (keV) . ... Excited energy(keV) . ...

Еще в разделе: (Показать все результаты (>22) - cdfe.sinp.msu.ru/ )

• CDFE - Centre for Photonuclear Experiments Data - Home page

The Faculty of History is located just near the new Library building. ... In order to be considered for admission, students must present a High School Certificate at the time of matriculation. ... The History Faculty enrolls MA, PhD. and research students for Post-Graduate Coursework. ... Our purpose is to facilitate and supplement the independent research of scholars and students on leave from their parent universities or research institutions. visa support with registration; . ...

Еще в разделе: (Показать все результаты (>112) - hist.msu.ru/ )

... FIELD | ... java.lang.Object common.Task . ... public class Task . ... private java.lang.String . ... private boolean . ... private java.util.Vector . ... static int . ... private UserInfo . userInfo . ... void . ... Method Detail public void setUserInfo ( UserInfo userInfo) . ... public void setFiles (java.util.Vector in, java.util.Vector inout, java.util.Vector out) . public void setHost (java.lang.String host, java.lang.String prog, java.lang.String cgibin, java.lang.String cgibinLocal) . ...

Еще в разделе: (Показать все результаты (>103) - angel.cs.msu.su/ )

Электронная библиотека Попечительского совета . ... McConnell S. - Code Complete . ... Название: Code Complete . Автор: McConnell S. Аннотация: . This practical handbook of software construction covers the art and science of the most important part of the development process. CODE COMPLETE provides a larger perspective on the software-development process and the role of construction in the process . ... Электронная библиотека попечительского совета мехмата МГУ , 2004-2016 . ...

Еще в разделе: (Показать все результаты (>11621) - lib.mexmat.ru/ )

• Ben-Ari M - Mathematical Logic for Computer Science :: Электронная библиотека
• Kneebone G.T. - Mathematical Logic and the Foundations of Mathematics: An
• Purcell J. - Linux Complete Command Reference :: Электронная библиотека

... Next message: [RU-NGI] Fwd: CERN CA Website IP change . ... FYI -------- Original Message -------- Subject: [ LCG-ROLLOUT ] [ EGI BROADCAST ] Decommission of gridops.org completed Date : Mon, 4 Jul 2011 12:51:56 +0200 From: EGI BROADCAST cic-information at IN2P3.FR Reply-To: LHC Computer Grid - Rollout LCG-ROLLOUT at JISCMAIL.AC.UK To: LCG-ROLLOUT at JISCMAIL.AC.UK ------------------------------------------------------------------------------------------------------------- ...

Еще в разделе: (Показать все результаты (>1313) - theory.sinp.msu.ru/ )

• Concept of user program implementation
• [RU-NGI] Fwd: CERN CA Website IP change
• The RU-NGI Third quarter 2011 Archive by thread