log . ... file . ... annotate . file log . ... find changesets by author, revision, files, or words in the commit message . ... author . ... dendik@10 . ... me@198 . ... bnagaev@61 . ... 11 # Temporary files from debianization . ... 12 debian /python-allpy/ . ... 13 debian /geometrical-core/ . ... 14 debian /*.substvars . ... 15 debian/*.debhelper* . ... 16 debian/*stamp* . ... 17 debian/files . ... 18 debian/control . ... 19 debian/*.log . ... 21 debian /tmp/ . ... 22 debian / pycompat . ...

Еще в разделе: (Показать все результаты (>112882) - kodomo.fbb.msu.ru/ )

• allpy: 1e5116ce9d75 .hgignore
• allpy: debian/rules annotate
• allpy: debian/compat annotate

... Previous Changeset . ... Completed Automata: change_size, import from State, default states . ... self.height = height €а . ... State("Alive", '+', black, [1] + range(4, 9))] €а . ... self.height += value €а . ... new_field[row].append(states[0].symbol) €а . ... for row in range(value, self.height): €а . ... for row in range(init, self.height): €а . ... for row in range(0, self.height): €а . ... if row > self.height + value - 1: continue €а . ... for row in range(self.height - term): €а . ...

Еще в разделе: (Показать все результаты (>5552) - kodomo.cmm.msu.ru/ )

ChangeLog for / # # Generated by Trac 0.12.5 # 04/11/16 21:39:31 Sat , 04 Dec 2010 20:44:37 GMT darkhan [23:c74a9885bf04] * Automata.py ( modified ) * State.py ( modified ) Comment in English Sat , 04 Dec 2010 20:39:27 GMT darkhan [22:749533cdfc67] * State.py ( modified ) State: readable comments Sat , 04 Dec 2010 20:32:41 GMT ...

Еще в разделе: (Показать все результаты (>1407) - kodomo.cmm.msu.su/ )

• http://kodomo.cmm.msu.su/trac/cca/log/?format=changelog&rev=bb4a79cc6b6e424a24496b907ff54ff51d63e1c8&stop_rev=20%3Aeef739e055f4&limit=100&mode=stop_on_copy
• http://kodomo.cmm.msu.su/trac/cca/log/?format=changelog&rev=bb4a79cc6b6e424a24496b907ff54ff51d63e1c8&stop_rev=19%3A3d1a72f49417&limit=100&mode=stop_on_copy
• http://kodomo.cmm.msu.su/trac/cca/log/?format=changelog&rev=23%3Ac74a9885bf04&limit=100&mode=stop_on_copy

... About lab . ... Selected publications . ... Projects . ... Medical image analysis . ... Selected completed projects . Text recognition . Geometric image parsing . Multiple object detection . ... Old projects . ... Online Journal "Computer graphics and multimedia" (in russian) . ... Text detection and recognition in natural images . ... 1) Automatic detection and understanding the text in natural images, such as photographs of city outdoors or building indoors, is a challenging problem. ...

Еще в разделе: (Показать все результаты (>108) - graphics.cs.msu.ru/ )

• Graphics and Media Lab | CMC department, Lomonosov Moscow State University
• Grants and contracts | Graphics and Media Lab
• Traffic sign recognition | Graphics and Media Lab

... Previous message: [Comphep-common] Re: A question. Next message: [Comphep-common] width and branching ratios in batch mode . ... Modern version of CompHEP generate unweighted events directly. ... I've already got a file 'events_N' and the next step is according > to manual > http://theory.sinp.msu.ru/comphep_html/tutorial/node44.html > execution of $COMPHEP/genEvents, but it is nowhere. > can you help me? > > cheers, pawel > -- Dr. Alexander Kryukov Inst. of Nuclear Physics, Moscow Univ, | ...

Еще в разделе: (Показать все результаты (>924) - theory.sinp.msu.ru/ )

• [RU-NGI] Fwd: [LCG-ROLLOUT] [EGI BROADCAST] Decommission of gridops.org
• [Comphep-common] Events to produce of LHAEF format
• The RU-NGI Third quarter 2011 Archive by thread

... Clarification of MPI_FINALIZE . ... Each process must call MPI_FINALIZE before it exits. ... MPI_FINALIZE is collective on MPI_COMM_WORLD. ... Although it is not required that all processes return from MPI_FINALIZE, it is required that at least process 0 in MPI_COMM_WORLD return, so that users can know that the MPI portion of the computation is over. In addition, in a POSIX environment, they may desire to supply an exit code for each process that returns from MPI_FINALIZE. ... Центры . ...

Еще в разделе: (Показать все результаты (>633) - www.parallel.ru/ )

• Clarifications | PARALLEL.RU - Информационно-аналитический центр по
• Communication Completion | PARALLEL.RU - Информационно-аналитический центр по
• MPI_Waitsome | PARALLEL.RU - Информационно-аналитический центр по параллельным

... 23.07.2015 . ... During July, this comet has increased markedly in brightness and has just passed its closest approach to Earth. ... Over the trees, far in the distance, are bright Venus and an even brighter crescent Moon . ... In the coming days and weeks, Comet C/2014 Q1 (PANSTARRS) will slowly move away from the Sun and the Earth, drift deep into southern skies, and fade. ... July 2015 . ... Publications with keywords: comet - Moon - Venus . Publications with words: comet - Moon - Venus . ...

Еще в разделе: (Показать все результаты (>4555) - www.astronet.ru/ )

• Journal "Peremennye Zvezdy"
• A Complete Aurora
• A Complete Solar Cycle from SOHO

... Each day a different image or photograph of our fascinating universe is featured, along with a brief explanation written by a professional astronomer. 2015 July 23 . Comet PanSTARRS, Moon, and Venus . ... Explanation: It is the object to the left of the big tree that's generating much recent excitement. ... Over the trees, far in the distance, are bright Venus and an even brighter crescent Moon . ... Follow APOD on: Facebook , Google Plus , or Twitter . ... About APOD | ...

Еще в разделе: (Показать все результаты (>2111) - www.sai.msu.su/ )

• SAL- Programming - Tools & Utilities - GRASP
• SAL- Database Systems - Relational DBMS - Recital
• SAL- Computer Graphics, Images Signals - Image Viewers, Conversions

Filename completion is only available if the the environment variables EDITOR and/or VISUAL are set to either emacs , gmacs or vi . For example: EDITOR=emacs . ... To complete a file or directory name with emacs or gmacs set press the ESC key twice. ls -l on<ESC><ESC> line_help . If the filename is not completed enter more characters until the filename can be uniquely identified. ... To complete a file or directory name with vi set press the \ (backward slash) key. ls -l on\ line_help . ...

Еще в разделе: (Показать все результаты (>80) - comet.sai.msu.ru/ )

• Filename completion with the C shell
• Filename completion with the TC shell
• Filename completion with the Bourne Again SHell

... Кафедра общей экологии Биологического факультета МГУ им. М.В. Ломоносова и . ... Активные темы Список участников Поиск по форуму Помощь . ... Экологический Форум - Фундаментальная Экология : Предложения и замечания по сайту . Тема: i just completed a whole powerpoint prese . ... Переход на форум -- Выберите форум -- О сайте "Фундаментальная экология" - Предложения и замечания по сайту Научные семинары - Научные семинары . Вы не можете публиковать новые темы в этом форуме . ...

Еще в разделе: (Показать все результаты (>3094) - www.sevin.ru/ )

• Экологический Форум - Фундаментальная Экология: Generate More Sales With One Of
• Экологический Форум - Фундаментальная Экология: Generate More Sales By Using
• Экологический Форум - Фундаментальная Экология: that will generate a peril on

mirroring wdcmirror ( ftp.wdc.com :/ drivers / hdutil ) completed successfully @ Thu Feb 27 00:45:37 MSK 1997 mirroring wdcmirror ( ftp.wdc.com :/ drivers / hdutil ) completed successfully @ Sun Mar 16 16:18:45 MSK 1997 Got INDEX.TXT 1613 Got allstar.exe 220223 Got wdatide.exe 72687 Got wd_diag.exe 60960 Got wd_clear.exe 54968 Got coretst.exe 33949 ...

Еще в разделе: (Показать все результаты (>15354) - crydee.sai.msu.ru/ )

• http://crydee.sai.msu.ru/ftproot/pub/comp/hardware/cdr/jarnold/.mirror
• http://crydee.sai.msu.ru/ftproot/pub/rec/music/lyrics/cs-uwp/n/new.order/movement.1
• http://crydee.sai.msu.ru/ftproot/pub/rec/games/idgames/levels/doom/m-o/origwad.txt

Электронная библиотека Попечительского совета . ... Smullyan R.M. - Recursion Theory for Metamathematics . ... Название: Recursion Theory for Metamathematics . Автор: Smullyan R.M. Аннотация: . ... The book deals mainly with those aspects of recursion theory that have applications to the metamathematics of incompleteness, undecidability, and related topics. ... Bar symmetric recursion theorem 116 . ... Электронная библиотека попечительского совета мехмата МГУ , 2004-2016 . ...

Еще в разделе: (Показать все результаты (>10100) - lib.mexmat.ru/ )

• Поиск книг, содержащих Complete graph :: Электронная библиотека попечительского
• McConnell S. - Code Complete :: Электронная библиотека попечительского совета
• Stenstroem B. - Ring of quotients. Introduction to methods of ring theory ::

... Online Services | ... Construct your query and output by sequental openings of needed fields. One output field must be selected (not be blank) at least. ... Query parameters: . Select for output . ... Energy (keV) . ... Y D H M S MS US NS PS FS AS EV KEV MEV or Stable . ... Energy of the ?-ray (keV) . ... Energy parameters of nucleus (B , Alpha energy, N, P separation energy) . ... Neutron separation energy (keV) . Proton separation energy (keV) . ... Excited energy(keV) . ...

Еще в разделе: (Показать все результаты (>15) - cdfe.sinp.msu.ru/ )

Network Working Group E. Harslem Rand Request for Comments: 225 UCSB NIC 7624 13 September 1971 Category: D.6 Updates: RFC #74 RAND/UCSB NETWORK GRAPHICS EXPERIMENT INTRODUCTION During the Network Graphics Meeting in July, several experiments were outlined to explore graphics over the Network. ... Stoughton [Page 1] RFC 225 RAND/UCSB NETWORK GRAPHICS EXPERIMENT September 1971 Input to the OLS was done via a Rand tablet on a VGS console. ... UCSB OLS INIT STATS | ... Dis- | ... UCSB OLS CONNECTED | ...

Еще в разделе: (Показать все результаты (>17670) - mirror.msu.net/ )

• http://mirror.msu.net/pub/rfc-editor/rfc-ed-all/pdfrfc/rfc225.txt.pdf
• http://mirror.msu.net/pub/gentoo-portage/sci-chemistry/gromacs/gromacs-5.0.4.ebuild
• http://mirror.msu.net/pub/gentoo-portage/sci-chemistry/gromacs/gromacs-5.0.5.ebuild

... FIELD | ... java.lang.Object common.Task . ... public class Task . ... private java.lang.String . ... private boolean . ... private java.util.Vector . ... static int . ... private UserInfo . userInfo . ... void . ... Method Detail public void setUserInfo ( UserInfo userInfo) . ... public void setFiles (java.util.Vector in, java.util.Vector inout, java.util.Vector out) . public void setHost (java.lang.String host, java.lang.String prog, java.lang.String cgibin, java.lang.String cgibinLocal) . ...

Еще в разделе: (Показать все результаты (>57) - angel.cs.msu.su/ )

... Shown that this calculation method may be applied for optimal completed of the laser cavities by the mirrors. ... 4]. , ( ) - sin j co s j Mj = pj (1 ) , - p sin co s j j j sin 2 1 1- j = arccos 2 2 nj , n j h j cos j , p j = n j cos j , j = 1- , - . ... rTE rTM . ... R = r r* ; TE TE TE : rTE = arctg Im rTE Re rTE rTM = arctg , Im rTM Re rTM - : : 0 rTM expi 2 Z= 0 - rTE exp - i 2 . ... M cw M ccw : M ccw =M cw cos( = si n ( ) ) - sin ( ) = S ( ) , cos( ) - . ... 11° L16. , (6). 10q 01(q+1), . ...

Еще в разделе: (Показать все результаты (>119) - nuclphys.sinp.msu.ru/ )

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>14) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/megablast.out

.

19. MCCMB'13

20. Apache module mod_dir