FASTA /TFASTA/FASTX/TFASTXv3(1) FASTA /TFASTA/FASTX/TFASTXv3(1) NAME fasta3, fasta3_t - scan a protein or DNA sequence library for similar sequences tfasta3, tfasta3_t - compare a protein sequence to a DNA sequence library , translating the DNA sequence library `on-the-fly'. fastx3, fastx3_t - compare a DNA sequence to a protein sequence ... REF_URL the format string used to define the option to lookup the library sequence in entrez, or some other database. ...

Еще в разделе: (Показать все результаты (>6609) - kodomo.cmm.msu.ru/ )

• TracImport (diff) тАУ Tanchiki
• TracImport тАУ Tanchiki

... BLAST (Basic Local Alignment Search Tool) is a set of similarity search programs designed to explore all of the available sequence databases regardless of whether the query is protein or DNA. ... The BLAST 2.0 search engine has been designed for optimal speed and sensitivity. ... Gapped BLAST and PSI-BLAST are useful search tools provided by the BLAST server (version 2.0) (Altschul et al., ... You can download blastcl3 form the anonymous FTP location ftp://ncbi.nlm.nih.gov/blast/network/netblast/ . ...

Еще в разделе: (Показать все результаты (>207) - www.genebee.msu.ru/ )

• Fasta3 help

Home . Database of structures of nucleic acid - protein complexes . ... List of complexes . Pfam families . SCOP families . Interaction classes . ... NPIDB . ... Information on SCOP and Pfam domains detected in protein chains is presented. ... Each family has its own web page with the list of entries that include domains of the family. ... List of SCOP domains occurred in DNA-protein and RNA-protein complexes is organized in tree-like form, according to the SCOP classification. ...

Еще в разделе: (Показать все результаты (>12) - npidb.belozersky.msu.ru/ )

• NPIDB: About Us

Modules | ... Apache HTTP Server Version 2.0 . ... Provides for user authentication using DBM files . ... This module provides for HTTP Basic Authentication, where the usernames and passwords are stored in DBM type database files. ... Combining Group and Password DBM files: In some cases it is easier to manage a single database which contains both the password and group details for each user. ... This program can be used to create and update DBM format password files for use with this module. ...

Еще в разделе: (Показать все результаты (>758) - itpm.msu.su/ )

• MySQL Reference Manual for version 3.23.10-alpha. - A Some MySQL users
• Overview of new features in Apache 2.0 - Apache HTTP Server
• mod_dav_fs - Apache HTTP Server

Modules | ... Apache HTTP Server Version 2.0 . ... Provides for user authentication using DBM files . ... This module provides for HTTP Basic Authentication, where the usernames and passwords are stored in DBM type database files. ... Combining Group and Password DBM files: In some cases it is easier to manage a single database which contains both the password and group details for each user. ... This program can be used to create and update DBM format password files for use with this module. ...

Еще в разделе: (Показать все результаты (>816) - uneex.lorien.cs.msu.su/ )

• mod_version - Apache HTTP Server
• Module Index - Apache HTTP Server
• Manual Dependencies

This module provides for user authentication using Berkeley DB files. ... AuthDBGroupFile . ... The AuthDBGroupFile directive sets the name of a DB file containing the list of user groups for user authentication. ... Combining Group and Password DB files: In some cases it is easier to manage a single database which contains both the password and group details for each user. ... The AuthDBUserFile directive sets the name of a DB file containing the list of users and passwords for user authentication. ...

Еще в разделе: (Показать все результаты (>129) - neptun.sai.msu.ru/ )

• Apache module mod_auth_dbm
• Apache module mod_userdir
• Apache module mod_negotiation

This module provides for user authentication using Berkeley DB files. ... AuthDBGroupFile . ... The AuthDBGroupFile directive sets the name of a DB file containing the list of user groups for user authentication. ... Combining Group and Password DB files: In some cases it is easier to manage a single database which contains both the password and group details for each user. ... The AuthDBUserFile directive sets the name of a DB file containing the list of users and passwords for user authentication. ...

Еще в разделе: (Показать все результаты (>1082) - oit.cmc.msu.ru/ )

• Apache module mod_auth_dbm
• Apache module mod_userdir
• version_compare

Gaby . Gaby is a small personal databases manager using GTK+ and Gnome (if available) for its GUI. It was designed to provide straight-forward access to databases a 'normal' user would like (addresses, books, ...) while keeping the ability to easily create databases for other needs. ... http://gaby.netpedia.net . ... Available Binary Packages: . ... GTK+ platforms . ... GTK+ . ... None . ... SAL Home | Database Systems | Utilities Other DBMS . ... SAL@KachinaTech.COM . ...

Еще в разделе: (Показать все результаты (>5570) - www.sai.msu.su/ )

• SAL- Database Systems - Object-Oriented DBMS - Objectivity/DB
• SAL- Database Systems - Relational DBMS - Pervasive.SQL
• Sternberg Astronomical Institute

This module is contained in the mod_userdir.c file, and is compiled in by default. ... Module: mod_userdir . ... A request for http :// www.foo.com /~ bob / one / two.html will be translated to: UserDir public_html - ~ bob /public_html/ one / two.html UserDir /usr/web - /usr/web/ bob / one / two.html UserDir /home/*/www - /home/ bob /www/ one / two.html The following directives will send redirects to the client: UserDir http :// www.foo.com /users - http :// www.foo.com /users/ ...

Еще в разделе: (Показать все результаты (>1049) - rtm-cs.sinp.msu.ru/ )

• Apache module mod_auth_db
• Apache module mod_auth_anon.c
• Module mod_cern_meta

... Next message: [RU-NGI] Fwd: [Noc-managers] EGI SVG Advisory 'High' RISK - DPM version in EPEL [EGI-SVG-2014-6963] . ... Original Message -------- Subject: [ Noc-managers ] EGI SVG Advisory ' High ' RISK - DPM version in EPEL [ EGI-SVG-2014-6963 ] Date: Mon, 12 May 2014 13:35:12 +0000 From: linda.cornwall at stfc.ac.uk To: site-security-contacts at mailman. egi .eu , ngi-security-contacts at mailman. egi .eu , noc-managers at mailman ...

Еще в разделе: (Показать все результаты (>12839) - theory.sinp.msu.ru/ )

• [Computer_algebra] [Fwd: [Fwd: New Version of REDUCE]]
• [RU-NGI] Fwd: [Noc-managers] Updated version of the EGI Acceptable Use Policy -
• LanHEP

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>35) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search

Next: WWW access Up: No Title Previous: Initial parameters of compact . The World Wide Web version provides the opportunity to construct an evolutionary track with all important parameters determined by the user at will from a broad range of available values. Figure: Part of the table for the defauly output. Some of the most unclear branches of the scenario can also be determined by the user. ... Figure: Graphical diagram for the default output . WWW access . ...

Еще в разделе: (Показать все результаты (>648) - xray.sai.msu.ru/ )

S .. ... a database of structures of DNA-protein and RNA-protein complexes. ... a program for finding hydrophobic clusters in 3D structures of macromolecules . ... search of conserved hydrophobic clusters in aligned 3D structures of protein families . ... a program for analysis of multiple alignments . ... a program for automatic detection of aligned blocks in a multiple protein alignment. ... a program for detection of aligned blocks in a multiple alignment of sequences of PDB chains. ...

Еще в разделе: (Показать все результаты (>6380) - monkey.belozersky.msu.ru/ )

• NPIDB
• SDPpred
• NPIDB project. Introduction

Number of cores used . ... Standard MP4(SDTQ) benchmark, Wall clock time and relative speedup . ... Intel Quad-core Core i7-2600K (3.4 GHz, overclocked to 3.5 GHz) CPU , Asus P8P67 mainboard, P67 chipset, 4x4GB (dual channel) DDR3-2000 RAM at 1900 MHz, three 1 TB SAMSUNG SATA-2 F3 HD103SJ HDDs in software RAID0, Suse Linux 11.3. ... Press to visit Firefly version 7.1.G Intel dual Quad-core Xeon W5580 benchmarks page . ... Press to visit PC GAMESS' Core 2 Quadro QX-6700 (Kentsfield) benchmarks page . ...

Еще в разделе: (Показать все результаты (>115) - classic.chem.msu.su/ )

• PC GAMESS version 7.1 to version 7.1.5 update information
• Firefly downloads area terms of use
• PC GAMESS/Firefly DOCUMENTATION - FAST MATRIX DIAGONALIZATION AND INVERSION

... What's new . ... The new version of the General Catalogue of Variable Stars (GCVS4.2) revised taking into account the new data accumulated since the 4th GCVS edition for the constellations: Canis Minor, Capricornus The new version of the GCVS ! ... The new version of the General Catalogue of Variable Stars (GCVS4.2) revised taking into account the new data accumulated since the 4th GCVS edition for the constellations: Apus, Cancer, Canes Venatici and Canis Major The new version of the GCVS ! ...

Еще в разделе: (Показать все результаты (>107) - sai.msu.ru/ )

• General Catalogue of Variable Stars: Description
• General Catalogue of Variable Stars: Vols I-III (the new electronic version).

. Russian version . About the Center . Publications . Workshops . Databases (in Russian) . Send Your remarks by email

Еще в разделе: (Показать все результаты (>134) - hist.msu.ru/ )

• Web-ресурсы по экономической истории

... Yevich R., Lawson S. - DB2 Universal Database for OS/390 Version 7.1 Certification Guide . ... Название: DB2 Universal Database for OS/390 Version 7.1 Certification Guide . Авторы: Yevich R., Lawson S. Аннотация: . This is part of the IBM Toronto Lab's DB2 Certification program. This book and CD-ROM will help candidates prepare for taking the Exam #512 and Exam #516 that leads to an IBM Certification in Database Administration for OS/390. ...

Еще в разделе: (Показать все результаты (>21026) - lib.mexmat.ru/ )

• Stinson C., Dodge M. - Microsoft Excel Version 2002 Inside Out :: Электронная
• Koonin S.E., Meredith D.C. - Computational Physics: Fortran Version ::
• Zikopoulos P.C., deRoos D., Baklarz G. - DB2 Version 8: The Official Guide ::

... Gadylshin K.G. and Tcheverda V.A. Nonlinear least-squares formulation for the inverse problem of seismic wave propagation is in the focus of computational geophysics community since 80th of the last century. Around the same time, the problem of trend component recovery becomes known. ... Key words: Helmholtz equation, macrovelocity component, forward map, full waveform inversion, singular value decomposition, resolution analysis. PDF (Full text in Russian, References in English) (491KB) . ...

Еще в разделе: (Показать все результаты (>354) - num-meth.srcc.msu.ru/ )

• "Cross-platform version of the T-system with an open architecture"
• "A comparison of algorithms for spiral tomography"
• "Integration of Fuzzy c-Means Clustering algorithm with PostgreSQL database

. You can compare any two versions of a file that is under the control of SCCS with the sccsdiff command: /usr/sccs/sccsdiff -r version -r version s. filename . Using this command produces a line by line difference between the two versions of the file. Results are shown in the same format as that produced by the diff command. Examples .

Еще в разделе: (Показать все результаты (>280) - comet.sai.msu.ru/ )

• Examples of comparing files with the sccsdiff command
• Printing files
• Dm. Bizyaev Home Page