... Length = 194692 Score = 28.2 bits (14), Expect = 1.0 Identities = 14/14 (100%) Strand = Plus / Plus Query: 14 gggattcgaacccc 27 || ... Sbjct: 157615 cccttagcaggggcgcctcttcagcc 157640 Score = 26.3 bits (13), Expect = 4.1 Identities = 13/13 (100%) Strand = Plus / Plus Query: 14 gggattcgaaccc 26 || Sbjct: 158927 gggattcgaaccc 158939 Score = 26.3 bits (13), Expect = 4.1 Identities = 13/13 (100%) Strand = Plus / Plus Query: 14 gggattcgaaccc 26 || ...

Еще в разделе: (Показать все результаты (>3816) - kodomo.cmm.msu.ru/ )

• http://kodomo.cmm.msu.ru/~phoenix/term3/resultblastn2.txt
• http://kodomo.cmm.msu.ru/~dragon98/term3/files/blasn.out
• http://kodomo.cmm.msu.ru/~ivyura/Term3/files/blastn_ss_res.txt

... Online Services | ... Construct your query and output by sequental openings of needed fields. One output field must be selected (not be blank) at least. ... Query parameters: . Select for output . ... Energy (keV) . ... Y D H M S MS US NS PS FS AS EV KEV MEV or Stable . ... Energy of the ?-ray (keV) . ... Energy parameters of nucleus (B , Alpha energy, N, P separation energy) . ... Neutron separation energy (keV) . Proton separation energy (keV) . ... Excited energy(keV) . ...

Еще в разделе: (Показать все результаты (>4919) - cdfe.sinp.msu.ru/ )

• CDFE - Centre for Photonuclear Experiments Data - Home page

PLTT DISCLAIMER: The PLTT makes no claims of ownership on the copyrighted works of O(+>, the artist formerly known as Prince, aka Prince Rogers Nelson. ... The PLTT, completely through voluntary work, hopes to provide the most comprehensive database of lyrics for the known works of this artist. ... We hope you enjoy our efforts, and contribute by making errors and opinions known to the PLTT by sending mail to pltt@umich.edu. (c) Copyright 1999 Prince Lyric Transcription Team ...

Еще в разделе: (Показать все результаты (>3700) - crydee.sai.msu.ru/ )

• Work notes

Next: Delivering Messages to Local Up: Routing Messages Previous: Routing Messages . smail expects to find the pathalias database in the paths file below /usr/lib/smail. This file is optional, so if you don't want to perform any pathalias routing at all, simply remove any existing paths file. paths must be a sorted ASCII file that contains entries which map destination site names to UUCP bang paths. The file has to be sorted because smail uses a binary search for looking up a site. ...

Еще в разделе: (Показать все результаты (>426) - itpm.msu.su/ )

• Dialing out with chat
• Configuration Sections - Apache HTTP Server
• MySQL Reference Manual for version 3.23.10-alpha. - A Some MySQL users

MCQDPT vs. XMCQDPT: low-lying excited states of O3 molecule Ilya G. Ryabinkin1 , Laboratory of Quantum Mechanics and Molecular Structure, Chemistry Department of Moscow State University, 119991, Leninskie Gory 1-3, Moscow, Russia. ... XMCQDPT: low-lying excited states of O3 Introduction: A brief overview of MCQDPT theory Reliable, cost-effective alternative to other multi-reference (MR) approaches, such as MR-CI(+Q), ic -MRCI, MR-AQCC and MR-ACPF. ... XMCQDPT: low-lying excited states of O3 ...

Еще в разделе: (Показать все результаты (>69) - classic.chem.msu.su/ )

. ЭКОЛОГИЧЕСКАЯ ИНФОРМАЦИЯ . WEB- ориентированная библиографическая база данных .

Еще в разделе: (Показать все результаты (>20) - ecoinformatica.srcc.msu.ru/ )

Home . ... Activities . ... Laboratory of Mathematical Methods of Image Processing . Chair of Mathematical Physics . ... Image enhancement . ... Rank image filtering . Image analysis . ... Ringing effect . ... Database . ... Medical imaging . ... Multiresolution analysis and processing . ... The final version of the developed ringing database is available here: . ... The ringing extension of TID 2013 database: . ...

Еще в разделе: (Показать все результаты (>157) - imaging.cmc.msu.ru/ )

• Ringing effect modeling | Laboratory of Mathematical Methods of Image...
• Ringing analysis | Laboratory of Mathematical Methods of Image Processing
• Research | Laboratory of Mathematical Methods of Image Processing

About BAFIZ . ... BAFIZ is a program devoted to the development of a distributed network of the knowledge and data bases for research of fundamental properties of the matter and applied nuclear physics. The project sponsored by Russian Foundation of Basic Research , RFBR reference number is 95-07-19502. ... This Page is developed at Laboratory of Computational Mathematics, . ... Last updated on 2 September 1999 . Copyright 1999 Laboratory of Computational Mathematics (DRCM) ...

Еще в разделе: (Показать все результаты (>26) - dbserv.sinp.msu.ru/ )

... About lab . ... Multiple object detection . ... Online Journal "Computer graphics and multimedia" (in russian) . ... To detect multiple objects of interest, the methods based on Hough transform use non-maxima supression or mode seeking in order to locate and to distinguish peaks in Hough images. ... Iterations of the Hough-like algorithm for multiple object instances detection: . ... Barinova O, Lempitsky V, Kohli P. On detection of multiple object instances using Hough transform . ...

Еще в разделе: (Показать все результаты (>234) - graphics.cs.msu.ru/ )

• Video processing | Graphics and Media Lab
• Automatic building texture completion | Graphics and Media Lab
• Selected completed projects | Graphics and Media Lab

... Alexey D. Neverov . ... Department of Bioengineering and Bioinformatics, Moscow State University. State Scientific Center GosNIIGenetika. ... EDAS human . EDAS mouse . EDAS dog (not availible now) . EDAS rat (not availible now) . To navigate this site please install the latest version of Macromedia Flash Player for Windows or for Linux . If you do not wish to install Flash you could use text pages with less functionality. ...

Еще в разделе: (Показать все результаты (>7) - edas2.bioinf.fbb.msu.ru/ )

• Alternative Splicing DataBase.
• EDAS (human) - Alternative Splicing DataBase.
• EDAS (mouse) - Alternative Splicing DataBase.

This feature is only available with the Bourne Again Shell (bash). ... To complete a command name press the TAB key. tel <TAB> net telnet> . ... Pressing the TAB key again displays all the commands on your path that begin with those letters. For example: ma <TAB><TAB> mach mail makecookie man maze macptopbm make makedepend mapname . ... Command name completion also works in the middle of a command line. For example the command name teln <TAB> orion.geo.aber . ...

Еще в разделе: (Показать все результаты (>212) - comet.sai.msu.ru/ )

• Filename completion with the Korn shell
• Filename completion
• Filename completion with the C shell

Выберите категорию обращения: Общие вопросы Отчеты Рейтинги Диссертационные советы Конкурсы Ввод данных Структура организаций Пользователи Проблемы с регистрацией\входом в систему . ... Войти в систему . ... Aloise S. , O?Keeffe P. , Cubaynes D. , Meyer M. , Grum-Grzhimailo A.N. в журнале Physical Review Letters , издательство American Physical Society (United States) , том 94, ? ... 2002 Strong, polarized Balmer-alpha fluorescence after resonant core excitation of HCl . ...

Еще в разделе: (Показать все результаты (>5752) - istina.msu.ru/ )

• Physics Letters, Section B: Nuclear, Elementary Particle and High-Energy
• Laiho R. - сотрудник | ИСТИНА - Интеллектуальная Система Тематического
• Physics Letters, Section A: General, Atomic and Solid State Physics - журнал |

In our model for RNA secondary structure formation we assume that each of the candidate helices (see definition in the main text) may exist in two states. A helix can be completely zipped, or it can be completely decayed. ... The following schema is used to estimate the effective transition constants between zipped and decayed states: . ... To determine the kinetic constants, we use the transition state theory, which is often used in chemical kinetics (Figure 2). ... Transition . ...

Еще в разделе: (Показать все результаты (>144) - bioinf.fbb.msu.ru/ )

• SDPsite - Gallery of examples
• User's guide

... Exciplexes with medium extent of electron transfer formed at the interaction of excited molecules with weak donors and acceptors (DGet> -0.2 eV) can be observed even in polar solvents contrary to the well investigated exciplexes with complete extent of electron transfer. ... hDn = H12/(1/ c12 - 1)1/2 - c14 (m02/a3) f(n2) . ... Parameters (H220-H110), H12, and (m02/a3) for each exciplex can be found by the fitting of the experimental dependence of hDn on f(e). ...

Еще в разделе: (Показать все результаты (>736) - chem.msu.ru/ )

• Similarity and difference of exciplexes with complete and partial electron
• Moscow University Chemistry Bulletin Vol. 49, No. 5, P. 306 (2008)
• Ivan Sorokin

Welcome to TWiki.. Users , Groups . ... Main ? ... ElenaZavyalova . ... TWikiUsersGuide - complete TWiki documentation, Quick Start to Reference . ... ChangePassword for changing your password . ChangeEmailAddress for changing your email address . TWikiUsers has a list of other TWiki users . UserDocumentationCategory is a list of TWiki user documentation . UserToolsCategory lists all TWiki user tools . ... Address: . ... Users . ... Copyright &© by the contributing authors. ...

Еще в разделе: (Показать все результаты (>37688) - dualopt1.cmm.msu.ru/ )

• AlexKopylov - Main - TWiki
• AndreyGolovin - Main - TWiki
• NewUserTemplate - TWiki - TWiki

. [ Войти ] . Главная -> Фильмы -> Expecting Love . Пользователи . Демо . Деньги . Фильмы . Форум . Expecting Love . Польша 2008 . отметить . Мелодрама . Комедия .

Еще в разделе: (Показать все результаты (>363) - kinfo.ru/ )

• Tales of the Unexpected - Фильмы - Kinfo.ru
• Expecting - Фильмы - Kinfo.ru
• The Unexpected Pest - Фильмы - Kinfo.ru

Data are provided with the intent that they are readily available for personal and public non-commercial use and may be reproduced, in part or in whole and by any means, without charge or further permission from IWSG. However, proper reference to contributors of original data to the database must be provided in all cases, and due diligence should be exercised in ensuring the accuracy of the materials reproduced . ... Bird species report. In : ARCTIC BIRDS breeding conditions survey . ...

Еще в разделе: (Показать все результаты (>3) - arctic.ss.msu.ru/ )

• BIRDS SPECIES DATABASE of the Arctic Birds Breeding Conditions Survey

Brain Research Group >> Research >> Change-point analysis ... << previous next >> . ... Unless in many other approaches to the analysis of different signal coupling, the information entering the analysis of synchronization in our approach is explicitly represented in the form of elementary, instantaneous events (the change-points). ... Hence the use of correlation/coherency estimates in parallel with change-point analysis seems to be quite rational. ...

Еще в разделе: (Показать все результаты (>64) - brain.bio.msu.ru/ )

• Unsolved problems and new prospects
• EEG Databases Links
• EEG Database - Schizophrenia

. Please use the reference to MASTER DataBase as Lipunov et al., 2010, MASTER Robotic Net, Advances in Astronomy, vol. 2010, pp. 1-7 . - days . MASTER , 2002-2016

Еще в разделе: (Показать все результаты (>3) - apollo.sai.msu.ru/ )

• Dome Kislovodsk Database ::
• Astelco Kislovodsk Database ::

... E. Huhlaev, Metamake Tools for Personal Project Preparation in Heterogeneous Network Environment (ID=260), Word doc . ... O. Kodolova, Experience with OO Database for CMS Events Distributed Between Two Sites (ID=294), PDF file . ... A. Nikitin, The GA Based Approach to Optimization of Parallel Calculations in Large Physics Problems (ID=220), Word doc . ... J. Seixas, Neural Particle Discrimination for Triggering Interesting Physics Channels Using Calorimetry Data (ID=311), PDF file . ...

Еще в разделе: (Показать все результаты (>55) - acat02.sinp.msu.ru/ )

• http://acat02.sinp.msu.ru/presentations/shawhan/shawhan_plenary.pdf
• http://acat02.sinp.msu.ru/presentations/mueller/folie.ps
• http://acat02.sinp.msu.ru/presentations/ososkov/ACATOsoskov.doc