... to_tsquery( [ configuration , ] querytext text) RETURNS TSQUERY . ... Query rewriting is a set of functions and operators for tsquery type. ... We'll expand query supernovae using table-driven rewriting rules. =# create table aliases (t tsquery primary key, s tsquery); =# insert into aliases values(to_tsquery('supernovae'), to_tsquery('supernovae|sn')); =# select rewrite(to_tsquery('supernovae'), 'select * from aliases') && to_tsquery('crab'); ?column? --------------------------------- ( 'supernova'...

Еще в разделе: (Показать все результаты (>414) - www.sai.msu.su/ )

• Zen: All changes for snrad queries
• Zen: Spatial Queries
• Zen: snrad queries

Maximum RPM: Taking the Red Hat Package Manager to the Limit . ... RPM's query mode is used to display information about packages: . Format: rpm --query <options> . ... Query all packages. -f <file> + ? Query package owning <file> . ... Query packages with group <group> . ... If no information selection option is present on the command line, RPM will simply display the applicable package label(s): . ... Display package information. -l ? Display package file list. -s ? ... Verify Mode ...

Еще в разделе: (Показать все результаты (>94) - uneex.lorien.cs.msu.su/ )

• A Few Handy Queries
• Index of /static/AltDocs_informatika2/Book2/ch_10_prolog/04_query
• Getting Information About Packages

PHP Manual . ... PHP 3 <= 3.0.18, PHP 4 >= 4.0.0) mysql_query -- Send a MySQL query . ... Only for SELECT statements mysql_query() returns a resource identifier or FALSE if the query was not executed correctly. ... The following query is syntactically invalid, so mysql_query() fails and returns FALSE : . ... php $result = mysql_query("SELECT * WHERE 1=1") or die("Invalid query"); ?> ... php $result = mysql_query("SELECT my_col FROM my_tbl") or exit ("Invalid query"); ?> . ... mysql_unbuffered_query ...

Еще в разделе: (Показать все результаты (>276) - oit.cmc.msu.ru/ )

• fbsql_query
• ifx_query
• mysql_unbuffered_query

... Querying File Parameters . Up: File Manipulation Next: File Info Previous: Querying the Size of a File . MPI_FILE_GET_GROUP(fh, group) . ... OUT group] group which opened the file (handle) . int MPI_File_get_group(MPI_File fh, MPI_Group *group) . MPI_FILE_GET_GROUP(FH, GROUP, IERROR) . ... MPI::Group MPI::File::Get_group() const . MPI_FILE_GET_GROUP returns a duplicate of the group of the communicator used to open the file associated with fh. ... MPI_FILE_GET_AMODE(fh, amode) . ...

Еще в разделе: (Показать все результаты (>84) - www.parallel.ru/ )

• Querying the Size of a File | PARALLEL.RU - Информационно-аналитический центр

Query: 1 atgactaaacactatgattacatcgccatcggcggcggcagcggcggtatcgcctccatc 60<br> ||||| |||||||||||||||||||| ||||||||||||||||||||||||||||| || <br> Sbjct: 2544 atgaccaaacactatgattacatcgctatcggcggcggcagcggcggtatcgcctcgatt 2603 <br> Query: 61 aaccgcgcggctatgtacggccagaaatgtgcgctgattgaagccaaagagctgggcggc 120 || ... Sbjct: 3504 ctctccgagcgcctgtttaacaacaagccggaagagcatctggactacagcaacatcccg 3563 Query: 1021 accgtggtcttcagccatccgccgattggtactgttggtttaacggaaccgcaggcgcgc 1080 || ...

Еще в разделе: (Показать все результаты (>1370) - kodomo.cmm.msu.ru/ )

• http://kodomo.cmm.msu.ru/~bennigsen/term3/prac8/bestalign.txt
• http://kodomo.cmm.msu.ru/~gmarusja/3_1/alignment.txt
• http://kodomo.cmm.msu.ru/~mamichev-ivan/Term_3/Blast/aligment.txt

AE008878 AE006468 |AE008878| ... Length = 22418 Score = 2861 bits (1443), Expect = 0.0 Identities = 2172/2415 (89%) Strand = Plus / Minus Query: 1 atgtcgaattcttatgactcctccagtatcaaagtcctgaaagggctggatgcggtgcgt 60 || Sbjct: 21203 atgtcgaattcttatgactcctccagtatcaaagtcctgaaagggctggatgcggtgcgt 21144 Query: 61 aagcgcccgggtatgtatatcggcgacacggatgacggcaccggtctgcaccacatggta 120 || ... Sbjct: 18863 atgggtgatgccgttgagccgcgtcgtgcctttatcgaggagaacgccctgaaagcagcg 18804 Query: 2401 aatatcgatatttaa 2415 || ...

Еще в разделе: (Показать все результаты (>3512) - kodomo.fbb.msu.ru/ )

• Alex Makarov. Personal Page. Blast.
• Query Results

General Catalog of Variable Stars (GCVS database, Version 2013Jun) . Samus N.N., Durlevich O.V., Kazarovets E V., Kireeva N.N., Pastukhova E.N., Zharova A.V., et al. ... General Catalogue of Variable Stars (Samus+ 2007-2012), VizieR On-line Data Catalog: B/gcvs . ... Query forms by files . The values in the input file must be separeted by comas or arranged in columns. ... Enter the file with the GCVS names: . ... Enter the file with the coordinates J2000.0: . ...

Еще в разделе: (Показать все результаты (>15) - www.sai.msu.ru/ )

... Enter Authors : (Last, F.I.) (one per line) Exact Author name search ( OR AND simple logic ) Shakura, N. Lipunov, V. Postnov, K. Prokhorov, M. Panchenko, I. Nazin, S. Ketsaris, N. Popov, S. Raguzova, N. Sazhin, M. Petrov ... Belokurov, V. Kosenko, D. Drozdova, D. Kuranov, A. Zeldovich, I. Zeldovich, J. Zeldovich, Y. Zelmanov, A. Zelmanoff, A. Publication Date : From: To: Month(MM) Year(YYYY) Month(MM) Year(YYYY) Enter Title Words : (Combine with: OR AND simple logic boolean ...

Еще в разделе: (Показать все результаты (>130) - xray.sai.msu.ru/ )

• ADS Abstract Service

. Search the Web Usenet and Display the Results in Standard Form in Compact Form in Detailed Form as a Count only . Use only Advanced Query Syntax with AND , OR , NOT and NEAR . Simple Query Syntax will not work! . Results Ranking Criteria: documents containing these words will be listed first. If left blank, the matching documents will not be sorted. Start date: End date: e.g. 21/Mar/96 .

Еще в разделе: (Показать все результаты (>14) - comet.sai.msu.ru/ )

• Query replace

... Пользователи -General- Common Current University Society Study Diaspora FAQ Real Estate -Technical- Development Hard&Soft Network Mobile -Market- Market Services Job -Hobby- Behemoth Health Love&Sex Еда Media Games Auto&Moto Sport Hobby Flood Zone -Servant- Alternative Forums Forum -Garbage- Revolution Garbage Private . ... Hibernate] native SQL Query . ... Creating a native SQL Query . ... Re: [Hibernate] native SQL Query [ re: Shurik ] . ... Re: [Hibernate] native SQL Query [ re: DarkGray ] . ...

Еще в разделе: (Показать все результаты (>11114) - www.fds-net.ru/ )

See PublishedAPI for packages intended to be used by Plugin and Contrib authors, or browse all packages . ... Child packages Child packages . Foswiki::Query::BinaryOP . ... Foswiki::Query::OP . ... Foswiki::Query::Parser - Parser for queries . Foswiki::Query::QueryAlgorithms - Interface to query algorithms (documentation only, this class does nothing). ... This topic: System > WebHome > ReferenceManual > DeveloperDocumentationCategory > PerlDoc . ... Copyright by the contributing authors. ...

Еще в разделе: (Показать все результаты (>3816) - wiki.cmc.msu.ru/ )

... Custom Query . ... Component . ... automata io requirements ui . ... And љ Blocked By Blocking Cc Component Created Description Keywords Milestone Modified Owner Priority Reporter Resolution Status Summary Ticket Type . Or љ Blocked By Blocking Cc Component Created Description Keywords Milestone Modified Owner Priority Reporter Resolution Status Summary Ticket Type . ... Summary Component Milestone Owner Type Status Priority Resolution Created Modified Blocked By Blocking Reporter Keywords Cc . ...

Еще в разделе: (Показать все результаты (>5) - kodomo.cmm.msu.su/ )

• Custom Query в?' Cyclyc Cell Automata

... Viescas J., Hernandez M.J. - SQL Queries for Mere Mortals: A Hands-on Guide to Data Manipulation in SQL [For Mere Mortals Series] . ... Название: SQL Queries for Mere Mortals: A Hands-on Guide to Data Manipulation in SQL [For Mere Mortals Series] . Авторы: Viescas J., Hernandez M.J. Аннотация: . ... This new edition of SQL Queries for Mere Mortals helps new users learn the foundations of SQL queries, and is an essential reference guide for intermediate and advanced users. ...

Еще в разделе: (Показать все результаты (>801) - lib.mexmat.ru/ )

• Signorile D.L. - SAP Query Reporting :: Электронная библиотека попечительского
• SAS Institute - SAS 9.1 SQL Query Window: User's Guide :: Электронная
• Din A.I. - Structured Query Language :: Электронная библиотека попечительского

... Extract new values for form fields from a query. $query - the query . metaObject - the meta object that is storing the form values . ... initialiseMissing - if true, will cause fields that are in the form but have no value in the query or in the meta to be initialised to ''. ... Returns the number of fields which had values provided by the query, and a references to an array of the names of mandatory fields that were missing from the query. ... new ClassMethod new ($session,$web,$form) . ...

Еще в разделе: (Показать все результаты (>26708) - dualopt1.cmm.msu.ru/ )

• TWikiQueryNodeDotPm - TWiki - TWiki
• TWikiQueryHoistREsDotPm - TWiki - TWiki
• %TOPICTITLE% ( vs. 1) - TWiki

Выберите категорию обращения: Общие вопросы Отчеты Рейтинги Диссертационные советы Конкурсы Ввод данных Структура организаций Пользователи Проблемы с регистрацией\входом в систему . ... Войти в систему . ...

Еще в разделе: (Показать все результаты (>329) - istina.msu.ru/ )

... Query forms . by GCVS name by identification by coordinates by type file query . ... Enter The Type of the Variability : ACV ACV+ DSCT : ACV+ DSCTC ACV: ACVO ACVO: ACYG ACYG: AM AM/XRM+E AM: BCEP BCEP (B) BCEP +E BCEP +E: BCEP +EA/D BCEP + ELL : BCEP : BCEPS BE BE: BLLAC BY BY+UV BY+UV: BY: BY:+E: CEP CEP(B) CEP: CST CST: CW: CWA CWA: CWB CWB: DCEP DCEP(B) DCEP: DCEPS DCEPS(B) DCEPS: DSCT DSCT (B) DSCT (B:) DSCT : DSCTC DSCTC (B) DSCTC +E DSCTC +E: DSCTC + ELL ...

Еще в разделе: (Показать все результаты (>37) - sai.msu.ru/ )

• General Catalogue of Variable Stars: What's new.

... Кафедра общей экологии Биологического факультета МГУ им. М.В. Ломоносова и . Институт проблем экологии и эволюции им. А.Н. Северцова РАН . Активные темы Список участников Поиск по форуму Помощь . ... Экологический Форум - Фундаментальная Экология : Предложения и замечания по сайту . Тема: Go Ahead And Take outlet Query Away From . ... Переход на форум -- Выберите форум -- О сайте "Фундаментальная экология" - Предложения и замечания по сайту Научные семинары - Научные семинары . ...

Еще в разделе: (Показать все результаты (>354) - www.sevin.ru/ )

... The deduced amino acid sequence of FDH from Mycobacterium vaccae N10 (McFDH) was identical to that of Pseudomonas sp. 101 (PsFDH) except for two amino acid residues: isoleucine-35 (threonine in PsFDH) and glutamate-61 (lysine in PsFDH). ... To examine the role of the two amino acid residues in the thermostability of the enzymes, glutamate-61 of McFDH was replaced by glutaminyl, prolyl and lysyl residues by site-directed mutagenesis. ...

Еще в разделе: (Показать все результаты (>45) - www.enzyme.chem.msu.ru/ )

. Name . Last Modified . Size . Type . Parent Directory / . - . Directory . ChangeLog . 2016-Jan-25 18:39:18 . 2.4K . application/octet-stream . ChangeLog-2015 . 2015-Nov-09 07:11:44 . 4.9K . application/octet-stream . Mail-SPF-Query-1.999.1-r1.ebuild . 2015-Aug-09 03:38:18 . 0.7K . text/plain . Manifest . 2016-Jan-25 18:39:18 . 1.8K . application/octet-stream . metadata.xml . 2016-Jan-25 02:06:09 . 0.4K . text/xml . lighttpd/1.4.35

Еще в разделе: (Показать все результаты (>4920) - mirror.msu.net/ )

... Online Services | ... Construct your query and output by sequental openings of needed fields. One output field must be selected (not be blank) at least. ... Query parameters: . Select for output . ... Energy (keV) . ... Y D H M S MS US NS PS FS AS EV KEV MEV or Stable . ... Energy of the ?-ray (keV) . ... Energy parameters of nucleus (B , Alpha energy, N, P separation energy) . ... Neutron separation energy (keV) . Proton separation energy (keV) . ... Excited energy(keV) . ...

Еще в разделе: (Показать все результаты (>181) - cdfe.sinp.msu.ru/ )