... Protein sequences: . ... OWL : non-redundant database assembled from a number of primary sources including translations of nucleic acid sequences (Swissprot, PIR, NRL3-D and GenPept). ... Database of protein families and HMMs (collection of multiple sequence alignments and hidden Markov models) . ... Collection of protein families constructed by clustering all complete protein sequences in SwissProt. ... The Genome Sequence Database: complete relational database of DNA sequences and annotation . ...

Еще в разделе: (Показать все результаты (>268) - www.genebee.msu.ru/ )

• GeneBee BLAST 2.2.8 Services
• BLAST Basic Overview
• GeneBee BLAST 2.2.22+ Services

The files containing information about Affymetrix microarrays were downloaded from the official Affymetrix site. ... Probe sequences were mapped to the genome using Blat. ... The hits found "probe alignment regions" were . ... We annotated each probe alignment region using the mRNA and EST alignments provided by UCSC, considering only . ... The textual part of the interface consists of probe information section, probe alignment section and transcription state . ... Each gene and each probe alignment . ...

Еще в разделе: (Показать все результаты (>11965) - mouse.belozersky.msu.ru/ )

... Protein sequences . ... European ribosomal RNA database . ... Thermodynamic database for protein-nucleic acids interactions (Japan) . ... Families of structurally similar proteins . ... Database of protein families and HMMs (collection of multiple sequence alignments and hidden Markov models) . ... Collection of protein families constructed by clustering complete protein sequences. ... Database issues of NAR: vol. 31 (2003) , vol. 32 (2004) , vol. 33 (2005) , vol. 34 (2006) , vol. 35 (2007) , vol. ...

Еще в разделе: (Показать все результаты (>6936) - monkey.belozersky.msu.ru/ )

• SVETKA, a program for multiple sequence alignments analysus
• About COGs
• About this project

You can search database for submitted information. ... Character * specifies arbitrary character sequence (eg. '*n' will result: John, Martin etc.) Character * is placed at end of line automatically ('Mar*' = 'Mar' will result: Martin, Martina etc.) Blank form will result ALL database records. ... Family name: . ... Topic: . ... Seismo-tectonics of Tsunami 3. Numerical and Analytical Models of Local Tsunami Behavior 4. ... Recent Local Tsunamis 8. ... Information . ... Database search . ...

Еще в разделе: (Показать все результаты (>28) - seac47-2.phys.msu.ru/ )

HMMER . The HMMER hidden Markov model software package and other software for large-scale genome analysis using probabilistic models of proteins and RNAs, from Sean Eddy's lab at Washington University, St. Louis USA. HMMER -- Hidden Markov models for sequence profile analysis. ... COVE -- an implementation of stochastic context free grammar methods for RNA sequence/structure analysis. ... SAL Home | Other Scientific Fields | Chemistry, Biology Related . ... SAL@KachinaTech.COM . ...

Еще в разделе: (Показать все результаты (>1698) - www.sai.msu.su/ )

• SAL- Other Scientific Fields - Chemistry, Biology Related - GEANFAMMER
• SAL -- Scientific Applications on Linux -- New Items Added in 1998/09 and
• WWW gateway to SAI databases

Evolution and Classification of GH101 Family Glycoside Hydrolases: Four Years Later Daniil G. Naumoff S. N. Winogradsky Institute of Microbiology, Russian Academy of Sciences, Prospekt 60-letiya Oktyabrya 7/2, Moscow 117312, Russia; daniil_naumoff@yahoo.com Recent progress in geno me sequencing resulted in a rapid growth of the sequence databases. The number of known representatives of all protein families has increased dramat ically. ... This family was described in 2005 [2]. ...

Еще в разделе: (Показать все результаты (>331) - mccmb.belozersky.msu.ru/ )

• http://mccmb.belozersky.msu.ru/2013/abstracts/abstracts/194.pdf
• http://mccmb.belozersky.msu.ru/2015/proceedings/abstracts/35.pdf
• http://mccmb.belozersky.msu.ru/2013/abstracts/abstracts/222.pdf

Home . ... Activities . ... Laboratory of Mathematical Methods of Image Processing . Chair of Mathematical Physics . ... Image enhancement . ... Rank image filtering . Image analysis . ... Ringing effect . ... Database . ... Medical imaging . ... Multiresolution analysis and processing . ... The final version of the developed ringing database is available here: . ... The ringing extension of TID 2013 database: . ...

Еще в разделе: (Показать все результаты (>287) - imaging.cmc.msu.ru/ )

• Research | Laboratory of Mathematical Methods of Image Processing
• Multiscale analysis for ringing estimation | Laboratory of Mathematical Methods

... Это база данных FASTA последовательностей белков-гистонов (а также ссылок на их описание в NCBI) и их 3D-структур. ... На тему этой БД была написана статья (S. Sullivan, D.W. Sink, K.L. Trout, I. Makalowska, P.M. Taylor, A.D. Baxevanis, D. Landsman (2002) The Histone Database. ... H2A . ... Swiss-Prot и TrEMBL на запрос 'Histone' ответили, что они знают 5983 таких белков, а UniProt нашел 10470 последовательностей. ... Таким образом, всего в БД UniProt находится 9899 гистонов, в БД Swiss-Prot - 3483....

Еще в разделе: (Показать все результаты (>5399) - kodomo.cmm.msu.ru/ )

• Summary Table Sequence
• SDAP : Structural Database of Allergenic Proteins
• page of Dovgan Kirill

Электронная библиотека Попечительского совета . ... Leon D., Markel S. - Sequence Analysis in a Nutshell . ... Название: Sequence Analysis in a Nutshell . Авторы: Leon D., Markel S. Аннотация: . Sequence Analysis in a Nutshell: A Guide to Common Tools and Databases pulls together all of the vital information about the most commonly used databases, analytical tools, and tables used in sequence analysis. ... Электронная библиотека попечительского совета мехмата МГУ , 2004-2016 . ...

Еще в разделе: (Показать все результаты (>12198) - lib.mexmat.ru/ )

• Siau K. - Research Issues in Systems Analysis and Design, Databases and
• Ratner B. - Statistical Modeling and Analysis for Database Marketing: Effective
• Brown S.M. - Bioinformatics: A Biologist's Guide to Biocomputing and the

Home . Database of structures of nucleic acid - protein complexes . ... List of complexes . Pfam families . SCOP families . Interaction classes . ... NPIDB . ... Information on SCOP and Pfam domains detected in protein chains is presented. ... Each family has its own web page with the list of entries that include domains of the family. ... List of SCOP domains occurred in DNA-protein and RNA-protein complexes is organized in tree-like form, according to the SCOP classification. ...

Еще в разделе: (Показать все результаты (>16) - npidb.belozersky.msu.ru/ )

XAFS spectroscopy is widely used in physics, materials science, chemistry (especially in catalysis and coordination chemistry), biology, geochemistry and environmental science. ... This is an interface to the Glimpse -based search engine which enables you to find published papers in different fields of x-ray absorption spectroscopy -- XAFS, EXAFS, XANES, NEXAFS, SEXAFS, XEOL, and EXAFS-like phenomena in photoemission, electron-energy-loss spectra and so on. ... Database Search Form . ...

Еще в разделе: (Показать все результаты (>3) - scon155.phys.msu.ru/ )

• XAFS Publication Database search form

... Query = PYRB_ECOLI P0A786 Aspartate carbamoyltransferase catalytic chain (EC 2.1.3.2) (Aspartate transcarbamylase) (ATCase). (311 letters) Database: pm 204 sequences; 2,269,587 total letters Searching..................................................done Score E Sequences producing significant alignments: ( bits ) Value embl |AE006119|AE006119 Pasteurella multocida subsp . multocida st... 77 9e-16 embl |AE006208|AE006208 Pasteurella Pm70 section 86 of 204 of the complete genome. ...

Еще в разделе: (Показать все результаты (>35224) - kodomo.fbb.msu.ru/ )

• http://kodomo.fbb.msu.ru/~element/Term3/blast_3.txt
• http://kodomo.fbb.msu.ru/~ogion/projects/Evolution_of_sequences/hemn_yp.blast
• http://kodomo.fbb.msu.ru/~xedin/Term2/Practice3/srs_tables.doc

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>34) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• Nhunt: program for nucleic acid sequence similarity search

Выберите категорию обращения: Общие вопросы Отчеты Рейтинги Диссертационные советы Конкурсы Ввод данных Структура организаций Пользователи Проблемы с регистрацией\входом в систему . ... Войти в систему . ... Koonin E.V. , Gorbalenya A.E. в журнале Protein sequences & data analysis , издательство Springer International (Berlin, Germany) , том 5, ? ...

Еще в разделе: (Показать все результаты (>3133) - istina.msu.ru/ )

• Advances in database technology : proceedings. International Conference on
• Distributed and Parallel Databases - журнал | ИСТИНА - Интеллектуальная Система
• International Journal of Intelligent Information and Database Systems - журнал

... Alexey D. Neverov . ... Department of Bioengineering and Bioinformatics, Moscow State University. State Scientific Center GosNIIGenetika. ... EDAS human . EDAS mouse . EDAS dog (not availible now) . EDAS rat (not availible now) . To navigate this site please install the latest version of Macromedia Flash Player for Windows or for Linux . If you do not wish to install Flash you could use text pages with less functionality. ...

Еще в разделе: (Показать все результаты (>7) - edas2.bioinf.fbb.msu.ru/ )

• EDAS (human) - Alternative Splicing DataBase.
• Alternative Splicing DataBase.
• EDAS (mouse) - Alternative Splicing DataBase.

. ЭКОЛОГИЧЕСКАЯ ИНФОРМАЦИЯ . WEB- ориентированная библиографическая база данных .

Еще в разделе: (Показать все результаты (>11) - ecoinformatica.srcc.msu.ru/ )

... GPP=$(tc-getCXX) ${CXXFLAGS}/ \ -e 's/--export-dynamic/-Wl,--export-dynamic/g' \ ${S}/Makefile || die cp config.makefile.template config.makefile sed -i -e '/^[ \t]*read/ d' -e 's/SHELL_ANS=0/SHELL_ANS=1/' ${S}/ arb _install.sh || die use amd64 sed -i -e 's/ ARB _64 := 0/ ARB _64 := 1/' config.makefile use opengl || sed -i -e 's/ OPENGL := 1/ ...

Еще в разделе: (Показать все результаты (>14701) - mirror.msu.net/ )

• http://mirror.msu.net/pub/gentoo-portage/sci-biology/arb/arb-5.2.ebuild
• http://mirror.msu.net/pub/gentoo-portage/sci-biology/arb/arb-5.3.ebuild
• FYI: 15

... The RADEN data bank produced at the Department of Chemistry of Moscow State University is designed as well to accumulate published information on radiative parameters of diatomic molecules, as to analyse it and recommend the more reliable values. ... electronic transition moments D ( R ); . ... dipole moments, . ... FACTUAL RECOMMENDED DATABASE contains now the ab initio and experimental electronic transition moments for more than 250 band systems which belong to more than 100 diatomic molecules. ...

Еще в разделе: (Показать все результаты (>52) - electr003.chem.msu.ru/ )

About BAFIZ . ... BAFIZ is a program devoted to the development of a distributed network of the knowledge and data bases for research of fundamental properties of the matter and applied nuclear physics. The project sponsored by Russian Foundation of Basic Research , RFBR reference number is 95-07-19502. ... This Page is developed at Laboratory of Computational Mathematics, . ... Last updated on 2 September 1999 . Copyright 1999 Laboratory of Computational Mathematics (DRCM) ...

Еще в разделе: (Показать все результаты (>24) - dbserv.sinp.msu.ru/ )

системы автоматизации, автоматизированные системы , информационные системы , мобильные и встраиваемые системы , программное обеспечение, вычислительные системы , средства связи,базы данных, информационные технологии,технологии программирования, обработка изображения, параллельные вычисления, информационное моделирование,математическое моделирование, вычислительный эксперимент, информатика,методы вычислений, численный анализ, numerical ...

Еще в разделе: (Показать все результаты (>132) - srcc.msu.ru/ )

• University Information System RUSSIA
• Структура НИВЦ