Электронная библиотека Попечительского совета . ... Rafanelli M. - Multidimensional Databases: Problems and Solutions . ... Название: Multidimensional Databases: Problems and Solutions . Автор: Rafanelli M. Аннотация: . Multidimensional Databases: Problems and Solutions strives to be the point of reference for the most important issues in the field of multidimensional databases. ... Электронная библиотека попечительского совета мехмата МГУ , 2004-2016 . ...

Еще в разделе: (Показать все результаты (>14952) - lib.mexmat.ru/ )

• Kowalski R. - Logic for problem solving :: Электронная библиотека

... Science and education . ... Scientific Laboratories . ... 3-d International Laser Graduate School "Modern Problems of Laser Physics LGS-2009 " . ... Main Science and education Scientific Laboratories Laboratory of theoretical problems in optics . ... Andreev Anatoliy Vasil'evich professor, Doctor of science . Konovko Andrey Andreevich Associate professor, Ph.D. Ponomarev Yuriy Vladimirovich Associate professor, Ph.D. Shutova Ol'ga Anatol'evna assistant professor, Ph.D. Ph.D. students . ...

Еще в разделе: (Показать все результаты (>700) - ofvp.phys.msu.ru/ )

... Alexey D. Neverov . ... Department of Bioengineering and Bioinformatics, Moscow State University. State Scientific Center GosNIIGenetika. ... EDAS human . EDAS mouse . EDAS dog (not availible now) . EDAS rat (not availible now) . To navigate this site please install the latest version of Macromedia Flash Player for Windows or for Linux . If you do not wish to install Flash you could use text pages with less functionality. ...

Еще в разделе: (Показать все результаты (>6) - edas2.bioinf.fbb.msu.ru/ )

• EDAS (human) - Alternative Splicing DataBase.
• EDAS (mouse) - Alternative Splicing DataBase.

... For robustness you have two systems and switch to the backup if you get problems you witch to the backup. ... MySQL doesn't (yet) have database replication, but here are some info on how do to it. ... You probably want to keep the old version to help with deciding what has been updated. ... DATABASE() . ... If you want to run multiple servers, the easiest way is to compile the servers with different TCP/IP ports and socket files so they are not both listening to the same TCP/IP port or socket file. ...

Еще в разделе: (Показать все результаты (>659) - itpm.msu.su/ )

• mod_auth_dbm - Apache HTTP Server
• ITPM MSU Web Page
• Support - Frequently Asked Questions - Apache HTTP Server

Database: . ... Affymetrix official site . ... Clone/Gene ID converter . ... Probe set search: . Affymetrix probe set identifier example: "200034_s_at" . ... Search . Text search: . Gene official symbol (*-wildcard) example: "c1orf*" . Word or phrase in gene official name example: "receptor" . ... Gene search: . ENSEMBL gene identifier example: "ENSG00000026508" . NCBI Entrez Gene identifier example: 7503 . ...

Еще в разделе: (Показать все результаты (>6945) - mouse.belozersky.msu.ru/ )

As it was already mentioned, the idea behind File Juggler is rather simple: using CGI scripts as processing tools and WWW browser as user interface, display the structure and content of typical anonymous FTP server in a convenient, easily navigated form. ... My P5-133 spends about 0.025 ms on one file when doing linear search with simple criterion (690 ms for 27,000 files, search for substring among file names/descriptions with 70 hits). ... Let's now look whether we can handle 1,000,000 files. ...

Еще в разделе: (Показать все результаты (>3156) - crydee.sai.msu.ru/ )

• Additional problems at the transition

The development of the method for the analysis of proteomics data Dmitry S. Ischenko, V. Popkov Moscow Institute of Physics and Technology, Dolgoprudny, Russia, ischenko.dmitry@gmail.com Dmitry G. Alexeev Scientific-Research Institute of Physicochemical medicine, Moscow, Russia, exappeal@gmail.com In the analysis of mass spectrometry data of unannotated sample the problem is in an adequate evaluation of the results. The question is: what to choose as a protein database for searching? ...

Еще в разделе: (Показать все результаты (>282) - mccmb.belozersky.msu.ru/ )

• http://mccmb.belozersky.msu.ru/2013/abstracts/abstracts/107.pdf
• http://mccmb.belozersky.msu.ru/2013/abstracts/abstracts/202.pdf
• http://mccmb.belozersky.msu.ru/2013/abstracts/abstracts/178.pdf

... Samokhvalov N.A. This paper presents an overview of methods for solving the problem of creation of the system supporting updatable XML-views over relational databases using query trees and proposes some further ways to extend the set of views supported. The rules of query tree creation proposed for the SQL/XML construction make it possible the realization of such an approach as a module of relational DBMS. ... PostScript (in Russian) (3.67MB) . PDF (in Russian) (1.20MB) . ...

Еще в разделе: (Показать все результаты (>538) - num-meth.srcc.msu.ru/ )

• "Methods of choosing a regularization parameter in the problem of linear
• Contents.Volume 4
• "An iterative method for solving a 3D electrical impedance tomography problem

. Skip to main content . News . About us . Staff . Current Staff . Who worked here . Scientific directions . History . Photos . Seminars . Classes . Main courses . Extra courses . Graduate study . Educational materials . Contacts . Choose language . Русский . English . Русский . English . Русский . Search . 119992 Moscow, GSP-1, Leninskie Gory, MSU, mechanics and mathematics department, OPU, Room 13-14 . tel. +7 (495) 939 56 32 . msu.opu @ gmail.com . Old version of the GPC departent sito

Еще в разделе: (Показать все результаты (>117) - new.math.msu.su/ )

• Scientific directions | Department: General Problems of Control. Faculty of
• Seminars of the department | Department: General Problems of Control. Faculty
• Current staff list | Department: General Problems of Control. Faculty of

This module provides for user authentication using DBM files. ... Source File: mod_auth_dbm.c . ... This module provides for HTTP Basic Authentication, where the usernames and passwords are stored in DBM type database files. ... AuthDBMGroupFile . ... Module: mod_auth_dbm . ... The AuthDBMUserFile directive sets the name of a DBM file containing the list of users and passwords for user authentication. ... This program can be used to create and update DBM format password files for use with this module. ...

Еще в разделе: (Показать все результаты (>110) - neptun.sai.msu.ru/ )

• Apache module mod_auth_db
• Apache HTTP Server: Notes about Compatibility with NCSA's Server
• MS Windows Netscape 3.0b4 KeepAlive problem solved

This module provides for user authentication using DBM files. ... Source File: mod_auth_dbm.c . ... This module provides for HTTP Basic Authentication, where the usernames and passwords are stored in DBM type database files. ... AuthDBMGroupFile . ... Module: mod_auth_dbm . ... The AuthDBMUserFile directive sets the name of a DBM file containing the list of users and passwords for user authentication. ... This program can be used to create and update DBM format password files for use with this module. ...

Еще в разделе: (Показать все результаты (>98) - oit.cmc.msu.ru/ )

• MySQL Reference Manual for version 3.22.27. - Table of Contents
• Apache module mod_auth_db
• Apache module mod_auth_anon.c

. filename : No such file or directory . The file you are tring to get or send does not exist. Most likely you have the filename wrong. Password: your password . 530 Login incorrect. Login failed. Can be caused by any one of: . you have used the wrong username on the remote host . you have used the wrong (or an incorrect) password . you do not have an account on this host .

Еще в разделе: (Показать все результаты (>258) - comet.sai.msu.ru/ )

• Problems with logging in
• Problems using rcp
• Problems linking files

Foundation # Distributed under the terms of the GNU General Public License v2 # $Id$ inherit eutils systemd user DESCRIPTION= SQLgrey is a postfix policy service implementing a grey-listing policy SRC_URI= mirror://sourceforge/ sqlgrey /${P}.tar.bz2 HOMEPAGE= http:// sqlgrey .sourceforge.net/ LICENSE= GPL-2 SLOT= 0 IUSE= ... L" ) SQLgrey_ACCESS_TYPE="l" einfo " local setup" echo break ;; "x" | ... M" ) SQLgrey_DB_TYPE="m" einfo " MySQL database backend" echo break ;; "s" | ...

Еще в разделе: (Показать все результаты (>47704) - mirror.msu.net/ )

• http://mirror.msu.net/pub/gentoo-portage/www-apps/moodle/files/postinstall-en.txt
• http://mirror.msu.net/pub/gentoo-portage/metadata/news/2010-03-01-mythtv-upgrade/2010-03-01-mythtv-upgrade.en.txt
• http://mirror.msu.net/pub/gentoo-portage/www-apps/phprojekt/files/postinstall-en.txt

. ЭКОЛОГИЧЕСКАЯ ИНФОРМАЦИЯ . WEB- ориентированная библиографическая база данных .

Еще в разделе: (Показать все результаты (>4) - ecoinformatica.srcc.msu.ru/ )

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>21) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search

Databases (NSDC) of the Natural Planetary Satellites. ... NSDC: Database of astrometric observations of Natural Planetary Satellites . ... They are thoroughly looking for observations in different sources, creating their owndatabases which are then mostly inaccessible to other researchers. ... In the file "content" with explications, the reference is given to the data source as well as the bibliographic reference. ... Data sources. ... Why a specific bibliographic database for Natural satellites? ...

Еще в разделе: (Показать все результаты (>245) - lnfm1.sai.msu.ru/ )

• Труды Ширмина Г.И.
• Problems

... About lab . ... Online Journal "Computer graphics and multimedia" (in russian) . ... To detect multiple objects of interest, the methods based on Hough transform use non-maxima supression or mode seeking in order to locate and to distinguish peaks in Hough images. ... Iterations of the Hough-like algorithm for multiple object instances detection: . ... Olga Barinova , Victor Lempitsky, Pushmeet Kohli, On detection of Multiple object instances using Hough transform , CVPR 2010 [pdf] . ...

Еще в разделе: (Показать все результаты (>153) - graphics.cs.msu.ru/ )

• Detection of multiple object instances using Hough transform | Лаборатория
• Saliency Map Estimation | Graphics and Media Lab
• Image Database Retrieval by Fast Hermite Projection Method | Graphics and Media

... To edit pages on this TWikiSite , you must have a registered user name and password. ... This database is accessible to anyone who can access the server through the web (though passwords will be encrypted, and e-mail addresses will be obfusticated to help prevent spamming). ... When TWiki receives the form, it will mail an account activation code to the e-mail address you gave above. ... Create your personal TWiki topic using your WikiName as topic name, and add the data you submitted to the topic. ...

Еще в разделе: (Показать все результаты (>50073) - dualopt1.cmm.msu.ru/ )

• %TOPICTITLE% ( vs. 1) - TWiki
• CGISessionDriverDBIDotPm - TWiki - TWiki
• CGISessionDriverMysqlDotPm - TWiki - TWiki

About BAFIZ . ... BAFIZ is a program devoted to the development of a distributed network of the knowledge and data bases for research of fundamental properties of the matter and applied nuclear physics. The project sponsored by Russian Foundation of Basic Research , RFBR reference number is 95-07-19502. ... This Page is developed at Laboratory of Computational Mathematics, . ... Last updated on 2 September 1999 . Copyright 1999 Laboratory of Computational Mathematics (DRCM) ...

Еще в разделе: (Показать все результаты (>22) - dbserv.sinp.msu.ru/ )

... Другие названия журнала: J. Inv. ill-posed problems , J. Inverse and Ill-posed Problems , J. Inverse and Ill-Posed Probl показать полностью.. J. of Inverse and Ill-posed Problems , Journal Inverse and Ill-Posed Problems , Journal of Inverse and Ill-posed Problems . ... Wang Y. , Yagola A.G. в журнале Journal of Inverse and Ill-Posed Problems , издательство V S P (Netherlands) , том 24, ? ... 2012 Numerical method for solving an inverse electrocardiography problem for a quasi stationary case . ...

Еще в разделе: (Показать все результаты (>1714) - istina.msu.ru/ )

• Inverse Problems - журнал | ИСТИНА - Интеллектуальная Система Тематического
• Problems of Information Transmission - журнал | ИСТИНА - Интеллектуальная
• Contemporary Problems of Ecology - журнал | ИСТИНА - Интеллектуальная Система