Электронная библиотека Попечительского совета . ... Mullins C.S. - Database Administration: The Complete Guide to Practices and Procedures . ... Название: Database Administration: The Complete Guide to Practices and Procedures . ... With Database Administration, database professionals now have a comprehensive sourcebook of strategies for delivering quality administration across today's challenging multi-DBMS environments. ... Электронная библиотека попечительского совета мехмата МГУ , 2004-2016 . ...

Еще в разделе: (Показать все результаты (>18415) - lib.mexmat.ru/ )

• Loney K. - Oracle Database 10g: The Complete Reference :: Электронная
• Parr T. - The Definitive ANTLR Reference: Building Domain-Specific Languages ::
• Loney K., Koch G. - Oracle8i: The Complete Reference :: Электронная библиотека

Next: Reverse Lookups Up: The Domain Name System Previous: Domain Name Servers . We have seen above that DNS does not only deal with IP-addresses of hosts, but also exchanges information on name servers. ... A single piece of information from the DNS database is called a resource record , or RR for short. ... Figure- shows a part of the domain database that is loaded into the name servers for the physics.groucho.edu zone. ... This comprises, for instance, the default time-to-live for all records. ...

Еще в разделе: (Показать все результаты (>605) - itpm.msu.su/ )

• Routing Messages
• Getting smail Up and Running
• Mail Routing on the Internet

... This tutorial is about how to setup typical FTS application using PostgreSQL. We create our configuration pg , which will be default for locale ru_RU.UTF-8 . ... We'll use postgresql specific dictionary using synonym template dictionary and store it under PG_ROOT/share/dicts_data directory. ... After vacuuming, we are ready to perform full-text search. =# select rank_cd(fts_index, q)as rank, title from pgweb, plainto_tsquery('create table') q where q @@ fts_index order by rank desc limit 10; . ...

Еще в разделе: (Показать все результаты (>9496) - www.sai.msu.su/ )

• SAL- Database Systems - Object-Oriented DBMS - ozone
• SAL- Database Systems - Relational DBMS - Recital
• SAL- Database Systems - Utilities Other DBMS - CodeBase

... LDAP is the Lightweight Directory Access Protocol, and is a protocol used to access "Directory Servers". ... Search surname entry $sr= ldap _ search ($ds, o=My Company, c=US , sn=S* ); echo Search result is .$sr. p ; echo Number of entires returned is . ldap _count_ entries ($ds,$sr). p ; echo Getting entries ... p ; $info = ldap _ get _ entries ($ds, $sr); ... ldap_get_attributes -- Get attributes from a search result entry . ... ldap_get_entries -- Get all result entries...

Еще в разделе: (Показать все результаты (>939) - oit.cmc.msu.ru/ )

• Definitions of terms used to describe Apache directives
• Apache module mod_auth_anon.c
• dbase_create

... This document provides a set of guidelines for the administration and operation of public Network Information Center (NIC) databases. The purpose is to formalize procedures for the responsible handling of the personal and organizational information maintained by NICs in publically accessible databases, and to improve the accuracy and accessibility of such data where appropriate. ... The first part contains recommendations for preventing unauthorized disclosure of information in NIC databases. ...

Еще в разделе: (Показать все результаты (>21692) - mirror.msu.net/ )

... Online Services | ... Construct your query and output by sequental openings of needed fields. One output field must be selected (not be blank) at least. ... Query parameters: . Select for output . ... Energy (keV) . ... Y D H M S MS US NS PS FS AS EV KEV MEV or Stable . ... Energy of the ?-ray (keV) . ... Energy parameters of nucleus (B , Alpha energy, N, P separation energy) . ... Neutron separation energy (keV) . Proton separation energy (keV) . ... Excited energy(keV) . ...

Еще в разделе: (Показать все результаты (>4914) - cdfe.sinp.msu.ru/ )

• CDFE - Centre for Photonuclear Experiments Data - Home page

Databases (NSDC) of the Natural Planetary Satellites. ... NSDC: Database of astrometric observations of Natural Planetary Satellites . ... They are thoroughly looking for observations in different sources, creating their owndatabases which are then mostly inaccessible to other researchers. ... In the file "content" with explications, the reference is given to the data source as well as the bibliographic reference. ... Data sources. ... Why a specific bibliographic database for Natural satellites? ...

Еще в разделе: (Показать все результаты (>198) - lnfm1.sai.msu.ru/ )

• Natural Satellites Data Center. Objectiv.
• Data bases of Natural Satellites. Documentation. Sources
• Data bases of Natural Satellites. Documentation. Manual

... Length = 194692 Score = 28.2 bits (14), Expect = 1.0 Identities = 14/14 (100%) Strand = Plus / Plus Query: 14 gggattcgaacccc 27 || ... Sbjct: 157615 cccttagcaggggcgcctcttcagcc 157640 Score = 26.3 bits (13), Expect = 4.1 Identities = 13/13 (100%) Strand = Plus / Plus Query: 14 gggattcgaaccc 26 || Sbjct: 158927 gggattcgaaccc 158939 Score = 26.3 bits (13), Expect = 4.1 Identities = 13/13 (100%) Strand = Plus / Plus Query: 14 gggattcgaaccc 26 || ...

Еще в разделе: (Показать все результаты (>2721) - kodomo.cmm.msu.ru/ )

• http://kodomo.cmm.msu.ru/~vanilin/3_1/tRNA_blastn.txt
• http://kodomo.cmm.msu.ru/~phoenix/term3/resultblastn2.txt
• http://kodomo.cmm.msu.ru/~ivyura/Term3/files/blastn_ss_res.txt

Submission Instructions Please read all instructions before completing the form. ... Name: | ... Name Phone | ... No Yes |( ... Are written and dated laboratory records and data available? ... Please provide date of defence or anticipated date of defence. ... Was the invention created using confidential information of a third party? ... result in similar information no longer being supplied to the University when | ... Inventor's signature(s) (if selecting option A, | ... Print Name Signature | ...

Еще в разделе: (Показать все результаты (>31) - innovation.msu.ru/ )

... I was born on February 15, 1971 in Moscow (Russia). From 1988 to 1994 I was a student of the Faculty of Physics of Moscow State University . From 1994 to 1997 I was a Post-graduate student of the Faculty of Physics of Moscow State University . From 1997 I am working for the Division of Theoretical High Energy Physics of the Skobeltsyn Institute of Nuclear Physics of Moscow State University as a scientific collaborator. ... QFTHEP'2001 (Moscow) . ... with my cat Piso . my cat Piso . ...

Еще в разделе: (Показать все результаты (>1088) - theory.sinp.msu.ru/ )

• intas:cern-intas03:task2 [THEP]
• тЬО intas:cern-intas03:task2 [THEP]
• [Computer_algebra] Hello:

... To simplify use of internationalised characters within WikiWords and attachment names, TWiki now supports UTF-8 URLs, converting on-the-fly to virtually any character set, including ISO-8859-*, KOI8-R, EUC-JP, and so on. ... A non-UTF-8 site character set (e.g. ISO-8859-*) is still used within TWiki, and in fact pages are stored and viewed entirely in the site character set - the browser dynamically converts URLs from the site character set into UTF-8, and TWiki converts them back again. ...

Еще в разделе: (Показать все результаты (>39147) - dualopt1.cmm.msu.ru/ )

• AppendixEncodeURLsWithUTF8 - TWiki - TWiki
• %TOPICTITLE% (5 vs. 6) - TWiki
• %TOPICTITLE% ( vs. 1) - TWiki

... About lab . ... Multiple object detection . ... Online Journal "Computer graphics and multimedia" (in russian) . ... To detect multiple objects of interest, the methods based on Hough transform use non-maxima supression or mode seeking in order to locate and to distinguish peaks in Hough images. ... Iterations of the Hough-like algorithm for multiple object instances detection: . ... Barinova O, Lempitsky V, Kohli P. On detection of multiple object instances using Hough transform . ...

Еще в разделе: (Показать все результаты (>202) - graphics.cs.msu.ru/ )

• Summer School on the Internet of Things 2016 | Graphics and Media Lab
• Selected completed projects | Graphics and Media Lab
• The Microsoft Machine Learning and Intelligence School will take place in Saint

Filename completion is only available if the the environment variables EDITOR and/or VISUAL are set to either emacs , gmacs or vi . For example: EDITOR=emacs . ... To complete a file or directory name with emacs or gmacs set press the ESC key twice. ls -l on<ESC><ESC> line_help . If the filename is not completed enter more characters until the filename can be uniquely identified. ... To complete a file or directory name with vi set press the \ (backward slash) key. ls -l on\ line_help . ...

Еще в разделе: (Показать все результаты (>294) - comet.sai.msu.ru/ )

• Filename completion with the Bourne Again SHell
• Filename completion with the TC shell
• Filename completion with the C shell

... MG1655, complete genome. (927 letters) Database: pm 204 sequences; 2,269,587 total letters Searching..................................................done Score E Sequences producing significant alignments: (bits) Value AE006203 Pasteurella multocida subsp. multocida str. Pm70 sectio.. ... 28 6.5 AE006163 Pasteurella multocida subsp. multocida str. ... Length = 10697 Score = 30.2 bits (15), Expect = 1.6 Identities = 15/15 (100%) Strand = Plus / Plus Query: 193 cgcatgattctgctt 207 || ...

Еще в разделе: (Показать все результаты (>10837) - kodomo.fbb.msu.ru/ )

• http://kodomo.fbb.msu.ru/~element/Term3/pm.txt
• http://kodomo.fbb.msu.ru/~element/Term3/search_3T.txt
• http://kodomo.fbb.msu.ru/FBB/year_05/term4/KEGG.pdf

... Protein sequences: . ... OWL : non-redundant database assembled from a number of primary sources including translations of nucleic acid sequences (Swissprot, PIR, NRL3-D and GenPept). ... Database of protein families and HMMs (collection of multiple sequence alignments and hidden Markov models) . ... Collection of protein families constructed by clustering all complete protein sequences in SwissProt. ... The Genome Sequence Database: complete relational database of DNA sequences and annotation . ...

Еще в разделе: (Показать все результаты (>201) - www.genebee.msu.ru/ )

• LMI projects
• BLAST Basic Overview
• GeneBee BLAST 2.2.8 Services Help

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>26) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/megablast.out

... Complete proteomes were extracted from these genomes and domain architectures were assigned to each protein using the Pfam domain database [6] and the COGs database [5]. ... PF02874 (CL0275) ATP-synt_ab_N (ATP synthase alpha/beta family, beta-barrel domain) PF00006 (CL0023) ATP-synt_ab (ATP synthase alpha/beta family, nucleotide-binding domain) PF00306 (\N) PF00231 (\N) PF00119 (\N) PF00137 (\N) ATP-synt_ab_C (ATP synthase alpha/beta chain, C terminal domain) ATP-synt (ATP synthase) Figure 1. ...

Еще в разделе: (Показать все результаты (>293) - mccmb.belozersky.msu.ru/ )

• http://mccmb.belozersky.msu.ru/2013/abstracts/abstracts/39.pdf
• http://mccmb.belozersky.msu.ru/2015/proceedings/abstracts/163.pdf
• http://mccmb.belozersky.msu.ru/2015/proceedings/abstracts/131.pdf

... The Document Character Set . Character encodings . ... As some character encodings cannot directly represent all characters an author may want to include in a document, HTML offers other mechanisms, called character references , for referring to any character. ... The document character set, however, does not suffice to allow user agents to correctly interpret HTML documents as they are typically exchanged -- encoded as a sequence of bytes in a file or during a network transmission. ...

Еще в разделе: (Показать все результаты (>5511) - crydee.sai.msu.ru/ )

• Work notes
• Generic routines

... Server Routines . Up: Establishing Communication Next: Client Routines Previous: Names, Addresses, Ports, and All That . A server makes itself available with two routines. ... MPI_OPEN_PORT(info, port_name) . ... MPI_OPEN_PORT(INFO, PORT_NAME, IERROR) . ... This function establishes a network address, encoded in the port_name string, at which the server will be able to accept connections from clients. port_name is supplied by the system, possibly using information in the info argument. ...

Еще в разделе: (Показать все результаты (>661) - www.parallel.ru/ )

• Overview | PARALLEL.RU - Информационно-аналитический центр по параллельным
• Environmental Inquiries | PARALLEL.RU - Информационно-аналитический центр по
• Window Creation | PARALLEL.RU - Информационно-аналитический центр по

. Compiled from literature sources . version 1.0 . Scientific name . Family . English common name . Native common names . General use . Specific uses . Reference

Еще в разделе: (Показать все результаты (>257) - herba.msu.ru/ )