... Online Services | ... Construct your query and output by sequental openings of needed fields. One output field must be selected (not be blank) at least. ... Query parameters: . Select for output . ... Energy (keV) . ... Y D H M S MS US NS PS FS AS EV KEV MEV or Stable . ... Energy of the ?-ray (keV) . ... Energy parameters of nucleus (B , Alpha energy, N, P separation energy) . ... Neutron separation energy (keV) . Proton separation energy (keV) . ... Excited energy(keV) . ...

Еще в разделе: (Показать все результаты (>16) - cdfe.sinp.msu.ru/ )

... Command Meanings IAC WILL SUPPRESS-GO-AHEAD The sender of this command requests permission to begin suppressing transmission of the TELNET GO AHEAD (GA) character when transmitting data characters, or the sender of this command confirms it will now begin suppressing transmission of GAs with transmitted data characters. ... Description of the Option When the SUPPRESS-GO-AHEAD option is in effect on the connection between a sender of data and the receiver of the data, the sender need not transmit GAs....

Еще в разделе: (Показать все результаты (>20276) - mirror.msu.net/ )

• http://mirror.msu.net/pub/rfc-editor/rfc-ed-all/pdfrfc/rfc858.txt.pdf
• http://mirror.msu.net/pub/rfc-editor/rfc-ed-all/rfc856.txt
• http://mirror.msu.net/pub/rfc-editor/rfc-ed-all/pdfrfc/rfc224.txt.pdf

... MPI_Cancel . Cancels a communication request #include "mpi.h" int MPI_Cancel( request ) MPI_Request *request; . ... When the computation completes, some of these receive requests may remain; using MPI_Cancel allows the user to cancel these unsatisfied requests. ... All MPI routines (except MPI_Wtime and MPI_Wtick ) return an error value; C routines as the value of the function and Fortran routines in the last argument. ... By default, this error handler aborts the MPI job. ... Центры . ...

Еще в разделе: (Показать все результаты (>707) - www.parallel.ru/ )

• Non-destructive Test of status | PARALLEL.RU - Информационно-аналитический

... The command to be executed can be given to pppd with the connect command line option. pppd will redirect the command's standard input and output to the serial line. ... Basically, a chat script consists of an alternating sequence of strings that we expect to receive from the remote system, and the answers we are to send. ... This is a typical excerpt from a chat script; ogin: b1ff ssword: s3kr3t This tells chat to wait for the remote system to send the login prompt, and return the login name b1ff. ...

Еще в разделе: (Показать все результаты (>638) - itpm.msu.su/ )

• The Login Chat
• Getting smail Up and Running

... Length = 194692 Score = 28.2 bits (14), Expect = 1.0 Identities = 14/14 (100%) Strand = Plus / Plus Query: 14 gggattcgaacccc 27 || ... Sbjct: 157615 cccttagcaggggcgcctcttcagcc 157640 Score = 26.3 bits (13), Expect = 4.1 Identities = 13/13 (100%) Strand = Plus / Plus Query: 14 gggattcgaaccc 26 || Sbjct: 158927 gggattcgaaccc 158939 Score = 26.3 bits (13), Expect = 4.1 Identities = 13/13 (100%) Strand = Plus / Plus Query: 14 gggattcgaaccc 26 || ...

Еще в разделе: (Показать все результаты (>2809) - kodomo.cmm.msu.ru/ )

• http://kodomo.cmm.msu.ru/~vanilin/3_1/tRNA_blastn.txt
• http://kodomo.cmm.msu.ru/~mmetelev/Term3/bln.txt
• http://kodomo.cmm.msu.ru/~contradiction/term3/bln_y.txt

This feature is only available with the Bourne Again Shell (bash). ... To complete a command name press the TAB key. tel <TAB> net telnet> . ... Pressing the TAB key again displays all the commands on your path that begin with those letters. For example: ma <TAB><TAB> mach mail makecookie man maze macptopbm make makedepend mapname . ... Command name completion also works in the middle of a command line. For example the command name teln <TAB> orion.geo.aber . ...

Еще в разделе: (Показать все результаты (>718) - comet.sai.msu.ru/ )

• Filename completion with the Bourne Again SHell
• Filename completion with the TC shell
• Filename completion with the C shell

... MG1655, complete genome. (927 letters) Database: pm 204 sequences; 2,269,587 total letters Searching..................................................done Score E Sequences producing significant alignments: (bits) Value AE006203 Pasteurella multocida subsp. multocida str. Pm70 sectio.. ... 28 6.5 AE006163 Pasteurella multocida subsp. multocida str. ... Length = 10697 Score = 30.2 bits (15), Expect = 1.6 Identities = 15/15 (100%) Strand = Plus / Plus Query: 193 cgcatgattctgctt 207 || ...

Еще в разделе: (Показать все результаты (>18023) - kodomo.fbb.msu.ru/ )

• http://kodomo.fbb.msu.ru/~element/Term3/pm.txt
• http://kodomo.fbb.msu.ru/~element/Term3/search_3T.txt
• http://kodomo.fbb.msu.ru/~podkovkina/v.txt

... Кафедра общей экологии Биологического факультета МГУ им. М.В. Ломоносова и . ... Активные темы Список участников Поиск по форуму Помощь . ... Экологический Форум - Фундаментальная Экология : Предложения и замечания по сайту . Тема: 80,000 March, expected are (Rolex) times . ... a href=http://cheapisabels.zohosites.com/><b>isabel marant</b></a> Her 58 shows in Europe, the US, Canada, Mexico and South America played for a staggering 2,350,282 million fans and sold over (USD)280,000,000 in tickets.. ...

Еще в разделе: (Показать все результаты (>5495) - www.sevin.ru/ )

• Экологический Форум - Фундаментальная Экология: Friday was expected to be the
• Экологический Форум - Фундаментальная Экология: regulate concerns expected and
• Экологический Форум - Фундаментальная Экология: case. benefits Expected the buy

Электронная библиотека Попечительского совета . ... Friberg J. - Unexpected Links Between Egyptian And Babylonian Mathematics . ... Название: Unexpected Links Between Egyptian And Babylonian Mathematics . ... Mesopotamian mathematics is known from a great number of cuneiform texts, most of them Old Babylonian, some Late Babylonian or pre-Old-Babylonian, and has been intensively studied during the last couple of decades. ... Электронная библиотека попечительского совета мехмата МГУ , 2004-2016 . ...

Еще в разделе: (Показать все результаты (>12759) - lib.mexmat.ru/ )

• Поиск книг, содержащих Expected running time :: Электронная библиотека
• Поиск книг, содержащих 'Математические досуги' (The Unexpected Hanging and
• Поиск книг, содержащих Математическое ожидание (expectation или expected value)

... 2005 November 20 . Rays from an Unexpected Aurora . ... For starters, on this Friday morning in August 2002, no intense auroral activity was expected at all. Possibly more surprising, however, the aurora appeared to show an usual structure of green rays from some locations. ... Large sunspot groups indicate that activity from an active Sun is relatively likely, possibly causing other streams of energetic particles to cascade onto the Earth and so causing more auroras . ... About APOD | ...

Еще в разделе: (Показать все результаты (>2686) - www.sai.msu.su/ )

• APOD: 2008 January 1 - Rays from an Unexpected Aurora
• APOD: 2002 August 5 - Rays from an Unexpected Aurora
• APOD: 2009 September 8 - Unexpected Impact on Jupiter

Astronomy Picture of the Day . APOD: 2008 January 1- Rays from an Unexpected Aurora . ... For starters, on this day in 2002, no intense auroral activity was expected at all. Possibly more surprising, however, the aurora appeared to show an usual structure of green rays from some locations. ... Mirroring the green rays is a red band, somewhat rare in its own right. ... January . ... January 2008 . ... NASA Web Site Statements, Warnings, and Disclaimers . ... Publications with keywords: aurora . ...

Еще в разделе: (Показать все результаты (>7296) - www.astronet.ru/ )

• Rays from an Unexpected Aurora
• Астронет > APOD: 2008 January 1- Rays from an Unexpected Aurora
• Астронет > Rays from an Unexpected Aurora

... The aim of this project is the development of a new group of "smart" or intelligent materials, i.e. materials capable to follow small change of external conditions in a preset way. ... They represent a new type of composites consisting of small magnetic particles dispersed within a highly elastic polymeric matrix. ... Another straightforward application of the magnetic composites which will be implemented in the course of this project is based on their magnetic field dependent elastic modulus. ...

Еще в разделе: (Показать все результаты (>128) - polly.phys.msu.ru/ )

• NATO Scientific Environmental Affairs

. [ Войти ] . Главная -> Фильмы -> Tales of the Unexpected . Пользователи . Демо . Деньги . Фильмы . Форум . Tales of the Unexpected . Великобритания 1979 . отметить . Сериал . Ужасы . Триллер .

Еще в разделе: (Показать все результаты (>2076) - kinfo.ru/ )

• The Unexpected Pest - Фильмы - Kinfo.ru
• An Unexpected Love - Фильмы - Kinfo.ru
• The Unexpected Mrs. Pollifax - Фильмы - Kinfo.ru

... Length=2222430 Score = 55.4 bits (60), Expect = 6e-08 Identities = 53/68 (78%), Gaps = 0/68 (0%) Strand=Plus/Plus Query 141 TTACTGGGCGTAAAGCGCACGCAGGCGGTTTGTTAAGTCAGATGTGAAATCCCCGGGCTC 200 || Sbjct 1090874 TTACTGGGCTTAAAGCGCCCGTAGCCGGCCCGGCAAGTCGCTCCTGAAATCCCCGGGCTC 1090933 Query 201 AACCTGGG 208 || ... Sbjct 2071246 AGCCGCGGTAATACGG 2071261 Score = 28.3 bits (30), Expect = 8.9 Identities = 15/15 (100%), Gaps = 0/15 (0%) Strand=Plus/Plus Query 222 ACTGGCAAGCTTGAG 236 || ...

Еще в разделе: (Показать все результаты (>19) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/blast_default.out

Next: The Present Situation in Up: No Title Previous: Case A: . Why it is possible that the Oppenheimer-Volkoff limit exceeds ? ... The lifetime of HSP (``hot'' spinar) is completely determined by the cooling time which is of the order of s according to different calculations. ... It seems very attractive to identify this cooling time with the mean characteristic gamma-ray burst duration s! . ... Finally, for the high Oppenheimer-Volkoff limit for the cool non-rotating object, when . ...

Еще в разделе: (Показать все результаты (>359) - xray.sai.msu.ru/ )

... Пользователи -General- Common Current University Society Study Diaspora FAQ Real Estate -Technical- Development Hard&Soft Network Mobile -Market- Market Services Job -Hobby- Behemoth Health Love&Sex Еда Media Games Auto&Moto Sport Hobby Flood Zone -Servant- Alternative Forums Forum -Garbage- Revolution Garbage Private . Hobby >> Media >> The Hobbit : An Unexpected Journey . ... The Hobbit : An Unexpected Journey [ re: SuperBizZzon ] . ... Re: The Hobbit : An Unexpected Journey [ re: snowman ] . ...

Еще в разделе: (Показать все результаты (>2537) - www.snto-msu.net/ )

• [php] "Unexpected $end" - не могу понять что за ошибка - Public forum of MSU
• wine 1.0 released - Public forum of MSU united student networks

... Пользователи -General- Common Current University Society Study Diaspora FAQ Real Estate -Technical- Development Hard&Soft Network Mobile -Market- Market Services Job -Hobby- Behemoth Health Love&Sex Еда Media Games Auto&Moto Sport Hobby Flood Zone -Servant- Alternative Forums Forum -Garbage- Revolution Garbage Private . Hobby >> Media >> The Hobbit : An Unexpected Journey . ... The Hobbit : An Unexpected Journey [ re: SuperBizZzon ] . ... Re: The Hobbit : An Unexpected Journey [ re: snowman ] . ...

Еще в разделе: (Показать все результаты (>3382) - www.fds-net.ru/ )

... 2000 March 12 . Supernova 1994D and the Unexpected Universe . Credit: High-Z Supernova Search Team , HST , NASA . Explanation: Far away, long ago, a star exploded. ... Supernova 1994D was not of interest for how different it was, but rather for how similar it was to other supernovae . ... The large number and great distances to supernovae measured over the past few years have been interpreted as indicating that we live in a previously unexpected universe . ... About APOD | ...

Еще в разделе: (Показать все результаты (>22) - www.arcetri.astro.it/ )

• APOD: December 30, 1998 - Supernova 1994D and the Unexpected Universe

DVM debugger - contents . Part 1 (1 - 4) . ... Writing to read-only variable is detected. ... Using non-initialized element <elem> . ... Using variable <var> before asynchronous reduction competed . ... The dynamic debugger detects access to a shadow element before asynchronous shadow renew competed . ... It is reported when any non-correspondence of trace or loop description file is detected. ... Different values of reduction operation are detected for current event and in reference trace record. ...

Еще в разделе: (Показать все результаты (>118) - sp.cs.msu.ru/ )

All Firefly versions can take optional command line arguments. ... firefly [optional command line options in any order] [optional list of working directories] . ... The list of most widely used command line options is given below: . ... Disables validity check of the command line arguments (e.g., check for valid names of files and directories, etc...) passed to Firefly. ... However, if this option is not given, one must provide the list of working directories when running Firefly in parallel mode. ...

Еще в разделе: (Показать все результаты (>71) - classic.chem.msu.su/ )

• PC GAMESS/Firefly DOCUMENTATION - P2P communication interface; dynamic load